Sequences from confirmation amplicon


Confirmation sequences for line 747E03 and hit At3g14090 are shown.
Line ID 747E03
Locus At3g14090 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:4670667
Primers used for PCR DN36 - 8474, show primer details
   
Sequence Name 39-K101830-0022-747-E03C-8409
GenBank Accession LN503302 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K101830-0022-747-E03C-8409
GCATTTACATTGAATAGATCCATCAACAACTTCCCACTCAAGCCTTTGAACATCACCAAT
GCTTATCTTCACAATCCCAAGCTGCTTAAATATTGCTTCCATGGCTGATTTGCGAACAGT
TCCATAGACTTGGATACATTCACGAGAGTAACCGGCGGCGACCATTCGTTGAACAATCGA
TCTTAGATCAGAAACTGCTTCCGGCGAAATCAGATCCATTTCTCGTATACTGCTAGTGGA
TCTGTAACTGCTTCTTCTACGAGTTAACCGGCTTGAACCGGAACCACCTGGAGAATTTAA
TTCTTCTTCTTCGGGAGTTACGGTGGTATCTTCTCCAACTTCGACGGTTAAAGACGGAGA
GACTGATGGTTCCTCGAGGAAAAGTGAATCAGGCTCGAAAGTAGTTGTGTGGGAGAGAAG
AATGTTACGAAACTCGT
   
Sequence Name 83-K101833-0022-747-E03C-DN36
GenBank Accession LN514291 [GenBank]
Sequencing primer gene specific primer, DN36: 5'-GACGAGTTCCGTAACATTCTTCTC-3'
Sequence (A. th genome BLAST matches underlined)
>83-K101833-0022-747-E03C-DN36
TTTTCTCGAGGAACCATCAGTCTCTCCGTCTTTACCGTCGAAGTTGGAGAAGATACCACC
GTAACTCCCGAAGAAGAAGAATTAAATTCTCCAGGTGGTTCCGGTTCAAGCCGGTTAACT
CGTAGAAGAAGCAGTTACAGATCCACTAGCAGTATACGAGAAATGGATCTGATTTCGCCG
GAAGCAGTTTCTGATCTAAGATCGATTGTTCAACGAATGGTCGCCGCCGGTTACTCTCGT
GAATGTATCCAAGTCTATGGAACTGTTCGCAAATCAGCCATGGAAGCAATATTTAAGCAG
CTTGGGATTGTGAAGATAAGCATTGGTGATGTTCAAAGGCTTGAGTGGGAAGTTGTTGAT
GGATCTATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGT
ATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAAT
GTAGATGTCCGCA

Last Updated on 23.10.2014 13:25