SimpleSearch - Line and FST details


Line specific information

 
Line ID 747E03
Vector Used pAC161
Line Availability only available from NASC (N471667)
Segregation Analysis 50:44:31
Confirmed for Hit At3g14090
Parent of DUPLO pair none
Parent of pair(s) 2902, 3034

Gene hit At3g14090

 
Sequence (A. th genome BLAST matches underlined)
>21-K024592-022-747-E03-8409
GTGCTGCGAAGATTTGCATTAGAGTTGTTTTCTCCATGGCATCGACCCTATACTGAGGCT
TATCTTCACAATCCCAAGCTGCTTAAATATTGCTTCCATGGCTGATTTGCGAACAGTTCC
ATAGACTTGGATACATTCACGAGAGTAACCGGCGGCGACCATTCGTTGAACAATCGATCT
TAGATCAGAAACTGCTTCCGGCGAAATCAGATCCATTTCTCGTATACTGCTATGGGATCC
TCCCTATAGTGAGACNTATTGCTCCCCCCCTTAATGGGACTTGGTGGCTCCGTGAGCTCA
AGGGACTACTTGGTAACGTTAACAATGGGGAAAGAGGTTGCTAGGGAAACTCGTCGGATA
GGAAATACGGAAAGTTTGAGCTACNAATGCCATGGAACCGAGTATATAGAAATAACGTGG
GAGCGGAAAGAGAGAGAGACTC
GenBank Accession BX946002 [GenBank]
Graphic View Graphic view of gene At3g14090
Predicted Position of Insertion Chr3:4670680 - go to primer design
BLAST e Value 2e-94
Hit Clone Code (BAC ID) MAG2
Hit Gene Code At3g14090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein D3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX946003 [GenBank]


Last Updated on 07.07.2016 14:03