Sequences from confirmation amplicon


Confirmation sequences for line 754H09 and hit At1g27320 are shown.
Line ID 754H09
Locus At1g27320 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:9488735
Primers used for PCR TK03 - 8474, show primer details
   
Sequence Name 33-K026694-022-754-H09C-8409
GenBank Accession LN500850 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K026694-022-754-H09C-8409
ATCCATATATTATCCTTGTGAACTGGGTTTTGTTCAAGAGAATACATCTTCCTAATAGTC
CAACCTTGTTGCCTCTCGAACTCTTCCCTCTCTGAATGGAGCACCCTCATAGCATAAGCT
ACCCCGCTAGTAAGAGGCCTCTCAAAGGAAGTTCTATCAGTGTACTCTGAGAATGTTCTC
TACACAAAGCTTCTTAATGTTAGTTACTGTTCACTAATACTCAAGAAGATAGGAATCAAG
CTACCAAGTGTTAGCTAAATACAAAGACTGTAAGCAACAATCAGCAAAATTGTAAATCCT
AACTGAAATTCGAGAGCAAGTTGAATGAAAAAAGCTACCATCATCCAAGGACCGTTCATA
TACTACACCGTAGGAACAACTTATGTACTACAAGCAAGACTAGATCTCAGGCATCAATCC
AAACAGATTAGAAGACAAGAAGATGCGGAATCGAGAATACCTGATCGATAGCAGAAGGAA
TCTTGCCATGGTGGAAGGTTGAGATCAAGATAGACATGGCTTGAACATGATTCATGCTAA
CGTTGAACTGATCCTGCAGCATACGAGCTCTCTCATCACACATACTAGCTAGCGTCTCTT
TCCTCTTCTCCATAGCTTGCGAGCTAAAGTACCAAAACGTCCAAATA
   
Sequence Name 34-K026694-022-754-H09C-TK03
GenBank Accession LN501271 [GenBank]
Sequencing primer gene specific primer, TK03: 5'-CTTCTGGGTCTTGGTCTCTATTTG-3'
Sequence (A. th genome BLAST matches underlined)
>34-K026694-022-754-H09C-TK03
CGTTTTGGTACTTTAGCTCGCAAGCTATGGAGAAGAGGAAAGAGACGCTAGCTAGTATGT
GTGATGAGAGAGCTCGTATGCTGCAGGATCAGTTCAACGTTAGCATGAATCATGTTCAAG
CCATGTCTATCTTGATCTCAACCTTCCACCATGGCAAGATTCCTTCTGCTATCGATCAGG
TATTCTCGATTCCGCATCTTCTTGTCTTCTAATCTGTTTGGATTGATGCCTGAGATCTAG
TCTTGCTTGTAGTACATAAGTTGTTCCTACGGTGTAGTATATGAACGGTCCTTGGATGAT
GGTAGCTTTTTTCATTCAACTTGCTCTCGAATTTCAGTTAGGATTTACAATTTTGCTGAT
TGTTGCTTACAGTCTTTGTATTTAGCTAACACTTGGTAGCTTGATTCCTATCTTCTTGAG
TATTAGTGAACAGTAACTAACATTAAGAAGCTTTGTGTAGAGAACATTCTCAGAGTACAC
TGATAGAACTTCCTTTGAGAGGCCTCTTACTAGCGGGGTAGCTTATGCTATGAGGGTGCT
CCATTCAGAGAGGGAAGAGTTCGAGAGGCAACAAGGTTGGACTATTAGGAAGATGTATTC
TCTTGAACAAAACCCTAGTTCACAAGGATAATATATGGATCAGCAATGAGTATGATGGTC
AATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCANAAATGTAGATGTC
CGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGT
ATTTATGGCGAAAGCAATA

Last Updated on 07.07.2016 14:16