SimpleSearch - Line and FST details


Line specific information

 
Line ID 754H09
Vector Used pAC161
Line Availability only available from NASC (N472381)
Segregation Analysis 50:50:47
Confirmed for Hit At1g27320
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g27320

 
Sequence (A. th genome BLAST matches underlined)
>72-K023905-022-754-H09-8409
TTGCCTCTCTAACTCTTCCCTGCTATGAATGGAGCACCCTCATACCCTAAGCTACCCCGC
TAGTAATAGGCCTCTCAAAGGAAGTTCTATCAATGTACTCTGACAATGTTCTCTACAGAT
CGCTTCTTAATGTTAGTGAGTGTTCACTAATACTCATGAGGAGGGGGGTCTTTATATGAA
ATGTTACCTAAATACAAAAATTGTAATTAATATTCATTATTATTGTATGAACCTGCAAAG
GTTCGATGGTCGGTAAACGGAAATAAGATACAGTAATAGAGTAGATATTTGAATTATTAC
TTAAAGAAAGTATATATAAT
GenBank Accession BX896305 [GenBank]
Graphic View Graphic view of gene At1g27320
Predicted Position of Insertion Chr1:9488699 - go to primer design
BLAST e Value 1e-49
Hit Clone Code (BAC ID) F17L21
Hit Gene Code At1g27320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histidine kinase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40