Sequences from confirmation amplicon


Confirmation sequences for line 761C04 and hit At1g02350 are shown.
Line ID 761C04
Locus At1g02350 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:470316
Primers used for PCR ER51 - 8474, show primer details
   
Sequence Name 38-K037448-022-761-C04C-ER51
GenBank Accession LN502900 [GenBank]
Sequencing primer gene specific primer, ER51: 5'-CCAAAAACTTAACAGAAAATTGGG-3'
Sequence (A. th genome BLAST matches underlined)
>38-K037448-022-761-C04C-ER51
GAGATGGAGCAGTCATCGCTACACTTTTGCTCTGTACAGAGAATATCCCCTCAGAGTTTC
ATAAGTCGAGTTGTATCCTCTGCTATCCATCTTAGTAATACTTGAGAGCTTCCTTAACTT
TGCAAGTTGCAACTCAACCTGCCCAAATAAAAAAAAAGATAATGATTTTTGCACTGTTCT
CATTGAAAAGGGTGAAAGAAAACAGATTCATTAGCATATAATACAATACCTTGCAGAGAT
TGCCTCTGGCAACATTGTGATTCCTTTCCTGAAAGAACCAACTGTTTGGGCCCTTTGGCT
TTGACAGAAGCGGCCTCAGTTTCCCATTCCACAACACAAACCTGGGAATGGGAAACAATA
TCTACCTGAATTACGCACACAACGACAAATGTAAATGGCTTCATGTCCGGGAAATCTACA
TGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTT
TTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGAT
AAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAA
TTCGGAAATCTTTATTTCGACGTGTCTACTT
   
Sequence Name 46-K037448-022-761-C04C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K037448-022-761-C04C-8409
TTTTATTATGTTTTTGGTAGAGAAGAAGGAGGAGTTTTTATTTTTTTTTTTTTTTTAAAA
AATTGATGTTTTCAGAATTTTTATTAAAAGAAGATAAATTTTTT

Last Updated on 23.10.2014 13:25