SimpleSearch - Line and FST details


Line specific information

 
Line ID 761C04
Vector Used pAC161
Line Availability only available from NASC (N472988)
Segregation Analysis 50:48:34
Confirmed for Hit At1g02350
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g02350

 
Sequence (A. th genome BLAST matches underlined)
>27-K024641-022-761-C04-8409
TTCTTTCACGAAAGGAATCACAATGTTGCCTGAGGCAATCTCTGCTTGGTATTGTATTAT
ATGCTAATGAATCTGTTTTCTTGCACCCTTTTCAATGAGAACAGTGCAAAAATCATTATC
TTTTTTTTTATTTGGGCAGGTTGAGTTGCAACTTGCAAAGTTAAGGACCCTCTCAAGTAT
TAATAAAATGGATAGCAAAGGATACAACTCCACTTATGACATTCTGAAGGGACAATCTCA
TTACTACACAAAGTGGTAAACTATGACTGCTCTCTCTACTGATAAATAAAGACATATTAC
CCACAAATTAATAGTAAAAGTATAAAAAGAATTATTAAATAACACAAAATGAAAGCATAA
TGATCAACTAATGAAGACCTCCAACAAAATAGAGAAATCTACCATATAAATTTGTTAC
GenBank Accession BX946372 [GenBank]
Graphic View Graphic view of gene At1g02350
Predicted Position of Insertion Chr1:470340 - go to primer design
BLAST e Value 6e-79
Hit Clone Code (BAC ID) T6A9
Hit Gene Code At1g02350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protoporphyrinogen oxidase-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX946372 [GenBank]


Last Updated on 31.08.2016 09:40