Sequences from confirmation amplicon


Confirmation sequences for line 779H11 and hit At1g78290 are shown.
Line ID 779H11
Locus At1g78290 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29458448
Primers used for PCR BG47 - 8474, show primer details
   
Sequence Name 17-K101744-0022-779-H11C-8409
GenBank Accession LN493792 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K101744-0022-779-H11C-8409
GCCATTTACATTGAATATCATCATCTCCATTTATCAATTCTGTCATTATTATCTAAATAA
ACATTTGTTTTAAAAAGAGAAAGAACCTAAAAGTCTTGTAAGAAACATTTTTCAGGCAAG
GTTTTTCTTTCAGCAGCTTATATCAGGAGTTAATTACTGTCACAGTCTTGTAAGAAACAT
AACATTCTAACTTAATCAAAAACGTTTTTTTTTTCTTTTCTTGTAAACAAAAAAATTAAA
AGTGTTTGTTTTTTTTTATGTTGGAAAATGAAGCAAATATGCCATAGAGATTTAAAGCTA
GAGAACACGTTACTTGATGGAAGCGAAGCGCCACGTGTAAAGATTTGCGACTTTGGATAT
TCAAAATCAGGAGTTCTTCATTCGCAACCAAAGACAACAGTGGGAACAA
   
Sequence Name 17-K101750-0022-779-H11C-BG47
GenBank Accession LN493793 [GenBank]
Sequencing primer gene specific primer, BG47: 5'-TGTTCCTACTGTTGTCTTTGGTTG-3'
Sequence (A. th genome BLAST matches underlined)
>17-K101750-0022-779-H11C-BG47
AAGTCGCAATCTTTACACGTGGCGCTTCGCTTCCATCAAGTAACGTGTTCTCTAGCTTTA
AATCTCTATGGCATATTTGCTTCATTTTCCAACATAAAAAAAAACAAACACTCTTAATTC
TTTTGTTTACAAGAAAAGAAAAAAAAAACGTTTTTGATTAAGTTAGAAGGTTATGTTTCT
TACAAGACTGTGACAGTAATTAACTCCGGATATAAGCTGCTGAAAGAAAAACCTTGCCGG
AAAAATGTTTCTTACAAGACTTTTAGGTTCTTTCTCTTTTTAAAACAAATGTTTATTTAG
ATAATAATGACAGAATTGATAAATGGAGATGATGATTTTCAATTGTAAATGGCTTCATGT
CCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAG
TAATTACCAATTTTTTTTCAATTCAAAAATGTAGATTTCCGCACGATTATA

Last Updated on 07.07.2016 14:16