SimpleSearch - Line and FST details


Line specific information

 
Line ID 779H11
Vector Used pAC161
Line Availability only available from NASC (N474783)
Segregation Analysis 50:32:27
Confirmed for Hit At1g78290
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g78290

 
Sequence (A. th genome BLAST matches underlined)
>88-K024662-022-779-H11-8409
AGCCATTTACATTGAATATCATCATCTCCATTTATCAATTCTGTCATTATTATCTAAATA
AACATTTGTTTTAAAAAGAGAAAGAACCTAAAAGTCTTGTAAGAAACATTTTTCAGGCAA
GGTTTTTCTTTCAGCAGCTTATATCAGGAGTTAATTACTGTCACAGTCTTGTAAGAAACA
TAACATTCTAACTTAATCAAAAACGTTTTTTTTTTCTTTTCTGGAAAACAAAAAAATTAA
AAGGGTTTGTTTTTTTTAAGGTGGAAAAAGGAACCAAAAAGGCCATAAAAATTAAAGCCT
AGGGAACCCCCCCAATAGGGGGAGATAGAGAAAGACCGGAACGCCAGGAAACAAAAATGT
GAATACCAAGGAATGGCGGGAAGCCGCATAATCAAAGAATAGTAGTAAGGAAAAGTTAAG
TGAAAAAAGACGCAATAGAGAAAAAGTGGAAAAGAAAATGAATAGGCTATAAGTAGAGGG
AAGAGAAGGTAAAATATATGACGGTACTAATTAAAAGAACAAA
GenBank Accession BX947458 [GenBank]
Graphic View Graphic view of gene At1g78290
Predicted Position of Insertion Chr1:29458453 - go to primer design
BLAST e Value 2e-94
Hit Clone Code (BAC ID) F3F9
Hit Gene Code At1g78290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03