Sequences from confirmation amplicon


Confirmation sequences for line 790E01 and hit At4g01520 are shown.
Line ID 790E01
Locus At4g01520 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:657658
Primers used for PCR NF41 - 8474, show primer details
   
Sequence Name 15-K102429w-0022-790-E01C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K102429w-0022-790-E01C-8409
TCGCCATTTTTTTCTCTCGCACGAGTGCATATTTATGATTTTATGAATATTTAATATTGT
GTTGTTTATATGTTTATGATTTTACGTTTTCTGTATTTCTTGACTTTAAAGCCAATCATT
AACTCAAATGGAATCCAGGTTAATATTTCTTCTTAAATTTCGTGCATTTTGTGTTTGTAT
TTACTCATGTTCTTGCTTTTTCTTTCCACTACATAATCTTCATTGATTCTTCTCTTCTAG
TTTTTGACCAACTTCCTTTTTAATCAAATTATGTCAAATTTATTTTTGTTTATACTTTAT
ACATTTTTAAAATTTGAAAAATTCATTTTTTTAATTATATTCTTACCATTCACTGAATAA
TTCATATTTGTTTGATTTATACCCTAACAATTTATGCAGTTGCTTAGAATTCGTTTTTAT
TTTTTATAAAAAAAAATTAAACACTAAAAGATATTTTTTAATAATATATTTCTAATAAAA
TAATTTTAAATATAAACTTTTATTTCGCCTATGTTCTTAAAAACCATTGGCACGGCTCTG
GACTCATGTGTGTGTGAAACCTTTGAAATTTA
   
Sequence Name 31-K102430-0022-790-E01C-NF41
GenBank Accession LN500107 [GenBank]
Sequencing primer gene specific primer, NF41: 5'-AAACAAATTCCAAAGGTTTCACAC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K102430-0022-790-E01C-NF41
CATGGTTTTTAGACATAGGCGAAATAAAGTTTATATTTAAAATTATTTTATTAGAAATAT
ATTATTAAAAAATATCTTTTAGTGTTTAATTTTTTTTTATAAAAAATAAAAACGAATTCT
AAGCAACTGCATAAATTGTTAGGGTATAAATCAAACAAATATGAATTATTCAGTGAATGG
TAAGAATATAATTAAAAAAATGAATTTTTCAAATTTTAAAAATGTATAAAGTATAAACAA
AAATAAATTTGACATAATTTGATTAAAAAGGAAGTTGGTCAAAAACTAGAAGAGAAGAAT
CAATGAAGATTATGTAGTGGAAAGAAAAAGCAAGAACATGAGTAAATACAAACACAAAAT
GCACGAAATTTAAGAAGAAATATTAACCTGGATTCCATTTGAGTTAATGATTGGCTTTAA
AGTCAAGAAATACAGAAAACGTAAAATCATAAACATATAAACAACACAATATTAAATATT
CATAAAATCATAAATATGCACTCGTGCGAGAGAAAAAAATGGCGATCTACATGTCCGGGA
AATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTA
CCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTAC
ATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAAT
TATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16