SimpleSearch - Line and FST details


Line specific information

 
Line ID 790E01
Vector Used pAC161
Line Availability only available from NASC (N475793)
Segregation Analysis 50:49:36
Confirmed for Hit At4g01520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g01520

 
Sequence (A. th genome BLAST matches underlined)
>05-K024935-022-790-E01-8409
GATCGCCATTTTTTTCTCTCGCACGAGTGCATATTTATGATTTTATGAATATTTAATATT
GTGTTGTTTATATGTTTATGATTTTACGTTTTCTGTATTTCTTGACTTTAAAGCCAATCA
TTAACTCAAATGGAATCCAGGTTAATATTTCTTCTTAAATTTCGTGCATTTTGTGTTTGT
ATTTACTCATGTTCTTGCTTTTTCTTTCCACTACATAATCTTCATTGATTCTTCTCTTCT
ATGGGATCCTCCCTATAGTGAGACCAATTAATCCCCCCTTTAATGTGAACTATGAAGACA
TTGGAATAAGCCACCTTCCTTTACCATTATCTTCACACAATATTGAGAAAAATCTGGGCT
ATGAACTCCGAAGAAAGTCTCCGGATAATAC
GenBank Accession BX948492 [GenBank]
Graphic View Graphic view of gene At4g01520
Predicted Position of Insertion Chr4:657650 - go to primer design
BLAST e Value 6e-79
Hit Clone Code (BAC ID) F11O4
Hit Gene Code At4g01520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 67
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23