Sequences from confirmation amplicon


Confirmation sequences for line 790E10 and hit At2g37600 are shown.
Line ID 790E10
Locus At2g37600 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15775040
Primers used for PCR NF39 - 8474, show primer details
   
Sequence Name 33-K102431-0022-790-E10C-8409
GenBank Accession LN500943 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K102431-0022-790-E10C-8409
CATTTACATTTCCACAAAAGCCTTATCTAATAAAGCAATAAACTTTGTAATCAGAGGGAA
GAAAGATTGATACCCCTTTGCGAGAATTGGGACGAGGAGCTAGCTCACGTCTGGTGACGA
CGTGTCCTTTGTTCAATCCAACGAACAAACCGGTCTTCACTGCTGGAGTTGTCATTTTTA
CCTGCAATTACTCAAAAGATTCACAGAGACTAAGTTAAGAAATCGATTTTGAAATCTAAA
CAACGGTAACGAAGATGAGAGCGTTTGATCAGATTCTCATACCTCTGCAATGGAGAAGCA
GCCGCTGCTACACAACGATTTTTGGAAAAAATGGAACTTTATATATGAAACGACAAAAGA
CAAAACCCTACAACATATTAACCAATTGGGCCTATTTGCTAAAAATAATTTAATGGCCCA
ATATATTGATCCAATTGAAACTTAAAACATTTGTATCTGATACAGGCCCAAAGCTATCTT
GTTAAA
   
Sequence Name 33-K102432-0022-790-E10C-NF39
GenBank Accession LN500944 [GenBank]
Sequencing primer gene specific primer, NF39: 5'-ATTAAACAAGATAGCTTTGGGCCT-3'
Sequence (A. th genome BLAST matches underlined)
>33-K102432-0022-790-E10C-NF39
CATTGGATCAATATATTGGGCCATTAAATTATTTTTAGCAAATAGGCCCAATTGGTTAAT
ATGTTGTAGGGTTTTGTCTTTTGTCGTTTCATATATAAAGTTCCATTTTTTCCAAAAATC
GTTGTGTAGCAGCGGCTGCTTCTCCATTGCAGAGGTATGAGAATCTGATCAAACGCTCTC
ATCTTCGTTACCGTTGTTTAGATTTCAAAATCGATTTCTTAACTTAGTCTCTGTGAATCT
TTTGAGTAATTGCAGGTAAAAATGACAACTCCAGCAGTGAAGACCGGTTTGTTCGTTGGA
TTGAACAAAGGACACGTCGTCACCAGACGTGAGCTAGCTCCTCGTCCCAATTCTCGCAAA
GGGGTATCAATCTTTCTTCCCTCTGATTACAAAGTTTATTGCTTTATTAGATAAGGCTTT
TGTGGAAATGGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGA
TGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAG
ATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCC
GTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGA
CGTGTCTACATT

Last Updated on 07.07.2016 14:16