SimpleSearch - Line and FST details


Line specific information

 
Line ID 790E10
Vector Used pAC161
Line Availability only available from NASC (N475802)
Segregation Analysis 50:49:38
Confirmed for Hit At2g37600
Parent of DUPLO pair none
Parent of pair(s) 6943, 6947

Gene hit At2g37600

 
Sequence (A. th genome BLAST matches underlined)
>77-K024935-022-790-E10-8409
TCAGAGGGAAGAATGATTGATACCCCTTTGCGAGAATTGGGACGAGGAGCTATGGGATCC
TCCCTATAGTGAGTCTTATTAATCCCTTCCTTTTCCTGATCTTTGGTCTTTCTGTTCTCA
ACGCTTTTGTTTTAAAATTTTTATTTATACAAGGGGGGGGGGGACCTTTTTTTTAAAATA
ACTGATTATGGAAATAGCTGGAATGGCTCCTTATGATACTAGCACCACTGAATCTTCTCC
CGTGTTATACCATCTACGTACTTTTCTATACCTGTCAAAATGTTACTTCTTTCATTGTTC
TATTCTTATTTATTTTTACAATCATTTCAAGTTCTTCGCTATTTCTTTTTTGGTTGCCCC
TAACTTTATTATTCTTTCTTCGTCTGCGGCGAGTGGTATACGAAGTTCTTTTATGTATAA
GTTCAACTGTTTGTATCTTTTCTTTATGACCATATTTATCGACATGTCTATTAACTTATC
GTGTGTTATGTTTGTACTTATTTAGTATACAACTTTTTATTTT
GenBank Accession BX948503 [GenBank]
Graphic View Graphic view of gene At2g37600
Predicted Position of Insertion Chr2:15775060 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) F13M22
Hit Gene Code At2g37600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L36e family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948504 [GenBank]


Last Updated on 14.10.2014 10:23