Sequences from confirmation amplicon


Confirmation sequences for line 792E01 and hit At5g50140 are shown.
Line ID 792E01
Locus At5g50140 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:20396449
Primers used for PCR NF36 - 8474, show primer details
   
Sequence Name 36-K102431-0022-792-E01C-8409
GenBank Accession LN502173 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>36-K102431-0022-792-E01C-8409
CATTTACAATTGAATTTATCCTGAATATATCATGAAGCCATTTACAATTATATTATTTGA
GAAGACTTACGGAGAGAAAGCCTACAGAGGCGGCAGCATGAAGCACAGTATTGCCCTCTC
CATCCAGCTCGTAGAGAAGTCTTCTTAGGTTGGCATTCTTGGCCATGAAAATAAAGGCTT
CCATCTTTTTGTGTCTGGCAGCTAAATGGAAAACTGTTTCGCTTGTTTGTAGTGTGACTG
AGTCGAAAGACAAGGGAGCTTTGTTGATAAACGCAGTCAGGGTTTCGACGGAGCCATTCA
TCACCGCGCAATGCAAAGGCGTAAAACCATCTTTATTCACCATTTCTGCAAGTTTTAGAT
CATTCGGCACTGTCTCCTCTAGGCTTTCTATGGACTCCGCTGTGGACTCTAACATCAGCA
GCAAGATGCTTGTGTGTCCCAATCTCGCAGCCAAATGGAGAGGTGTGTCACTTTTGGTGT
   
Sequence Name 36-K102432-0022-792-E01C-NF36
GenBank Accession LN502174 [GenBank]
Sequencing primer gene specific primer, NF36: 5'-CAGTTCCACTAACACCAAAAGTGA-3'
Sequence (A. th genome BLAST matches underlined)
>36-K102432-0022-792-E01C-NF36
GCATCTTGCTGCTGATGTTAGAGTCCACAGCGGAGTCCATAGAAAGCCTAGAGGAGACAG
TGCCGAATGATCTAAAACTTGCAGAAATGGTGAATAAAGATGGTTTTACGCCTTTGCATT
GCGCGGTGATGAATGGCTCCGTCGAAACCCTGACTGCGTTTATCAACAAAGCTCCCTTGT
CTTTCGACTCAGTCACACTACAAACAAGCGAAACAGTTTTCCATTTAGCTGCCAGACACA
AAAAGATGGAAGCCTTTATTTTCATGGCCAAGAATGCCAACCTAAGAAGACTTCTCTACG
AGCTGGATGGAGAGGGCAATACTGTGCTTCATGCTGCCGCCTCTGTAGGCTTTCTCTCCG
TAAGTCTTCTCAAATAATATAATTGTAAATGGCTTCATGATATATTCAGGATAAATTCAA
TTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
CATTC

Last Updated on 07.07.2016 14:16