SimpleSearch - Line and FST details


Line specific information

 
Line ID 792E01
Vector Used pAC161
Line Availability only available from NASC (N475985)
Segregation Analysis 50:49:32
Confirmed for Hit At5g50140
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g50140

 
Sequence (A. th genome BLAST matches underlined)
>05-K024948-022-792-E01-8409
CATTTACAATTGAATTTATCCTGAATATATCATGAAGCCATTTACAATTATATTATTTGA
GAAGACTTACGGAGAGAAAGCCTACAGAGGCGGCAGCATGAAGCACAGTATTGCCCTCTC
CATCCAGCTCGTAGAGAAGTCTTCTTAGGTTGGCATTCTTGGCCATGAAAATAAAGGCTT
CCATCTTTTTGTGTCTGGCAGCTAAATGGAAAACTGTTTCGCTTGTTTGTAGTGTGACTG
AGTCGAAAGACAAGGGAGCTTTGTTGATAAACGCAGTCAGGGTTTCGACGGAGCCATTCA
TCACCGCGCAATGCAAAGGCGTAAAACCATCTTTATTCACCATTTCTGCAAGTTTTAGAT
CATTCGGCACTGTCTCCTCTATGGGATCCTCCCTATAGTGAGTCGAAGTCAGCAAAGATG
TACCGGGTGGAGGTGAATAAAATGTATTTTTGTA
GenBank Accession BX948714 [GenBank]
Graphic View Graphic view of gene At5g50140
Predicted Position of Insertion Chr5:20396474 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MPF21
Hit Gene Code At5g50140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03