Sequences from confirmation amplicon


Confirmation sequences for line 793H12 and hit At4g23550 are shown.
Line ID 793H12
Locus At4g23550 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:12292158
Primers used for PCR IS74 - 8474, show primer details
   
Sequence Name 29-K026485-022-793-H12C-8409
GenBank Accession LN499138 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K026485-022-793-H12C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAAGAAATTTAAGAGGGTCAAATTCTTG
AAGTTCGGATATGATCAGCTCTTGATCCGTTGGATAAAAGACAACCATGTGATCGTTGTT
TCTTGTCATCTCGGAAAGGTTTTGAATCTTCAGGGAGAGAGACCGAGCTTGTGAGGATCG
TTTGTGTGGAGAAAGGGTAAAAGGGTTTGTAAAGTTCACCGAGCTCATCTAAGCCACTTG
TCTCCATCTCCGGTTCGTAGAAACTAGACGTCTCCATCGGTAGGCAAAACGAAGGTGAAA
ACGTACCGGAACTTTCGCCGGAAAACGCGTCTCCGGAGCCGGAGTAGCCTCTGACTATTG
CTTCTAGGTCTCCTTCGTCCATATAAGCCACCTCACCCATATATCT
   
Sequence Name 30-K026485-022-793-H12C-IS74
GenBank Accession LN499575 [GenBank]
Sequencing primer gene specific primer, IS74: 5'-GAGATATATGGGTGAGGTGGCTTA-3'
Sequence (A. th genome BLAST matches underlined)
>30-K026485-022-793-H12C-IS74
TATGGACGAAGGAGACCTAGAAGCAATAGTCAGAGGCTACTCCGGCTCCGGAGACGCGTT
TTCCGGCGAAAGTTCCGGTACGTTTTCACCTTCGTTTTGCCTACCGATGGAGACGTCTAG
TTTCTACGAACCGGAGATGGAGACAAGTGGCTTAGATGAGCTCGGTGAACTTTACAAACC
CTTTTACCCTTTCTCCACACAAACGATCCTCACAAGCTCGGTCTCTCTCCCTGAAGATTC
AAAACCTTTCCGAGATGACAAGAAACAACGATCACATGGTTGTCTTTTATCCAACGGATC
AAGAGCTGATCATATCCGAACTTCAAGAATTTGACCCTCTTAAATTTCTTCAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 07.07.2016 14:16