SimpleSearch - Line and FST details


Line specific information

 
Line ID 793H12
Vector Used pAC161
Line Availability only available from NASC (N476128)
Segregation Analysis 50:50:45
Confirmed for Hit At4g23550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g23550

 
Sequence (A. th genome BLAST matches underlined)
>96-K025016-022-793-H12-8409
CATTTACAATTGAAGAATTTAAGAGGGTCAAATTCTTGAAGTTCCGATATGATCAGCTCT
TGATCCGTTGGATAAAAGACAACCATGTGATCGTTGTTTCTTGTCATCTCGGAAAGGTTT
TGAATCTTCAGGGAGAGAGACCGAGCTTGTGAGGATCGTTTGTGTGGAGAAAGGGTAAAA
GGGTTTGTAAAGTTAGAGAAGGGGGGGGGGCGAGGTTGTCCAATATAAGAAATCGAAAAA
CTAGGGAGTACAGTCTGAAGGGAGAACAAAGTATGAAAAAAAGGAAGGGAAAGAAGAATA
TGAAGAATACCAAGAGAAGAGGTAACTTATTGGGGAAGATAGGGAAATAGGAGTATGAAA
GGAGAAAAGAGGAAGGCGAGATATAA
GenBank Accession BX948879 [GenBank]
Graphic View Graphic view of gene At4g23550
Predicted Position of Insertion Chr4:12292167 - go to primer design
BLAST e Value 2e-79
Hit Clone Code (BAC ID) F9D16
Hit Gene Code At4g23550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX948879 [GenBank]


Last Updated on 31.08.2016 09:40