Sequences from confirmation amplicon


Confirmation sequences for line 795H05 and hit At3g49360 are shown.
Line ID 795H05
Locus At3g49360 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:18304346
Primers used for PCR NF33 - 8474, show primer details
   
Sequence Name 39-K102431-0022-795-H05C-8409
GenBank Accession LN503307 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K102431-0022-795-H05C-8409
TCGGACATGAGCATTTACAATTGGAGTATGATGGCTTGCAATTGGAGGAGACTTGCTTCT
TAAAGGGAAAGTGAGTGAAGGATTCTTTCCAAGTGAATGAGACAAAAAAATCTGTTTTCT
TCTAAGAAAGAATATGATTTTCTATAAAACTACATCTTGATTTGTTTTTTGGAAGATTAG
TATCTAAATGTATCTTATACCTTTCTTCTGTTTGTAGTTTACTCATTACAACCTTTTATT
ATTCCTTTCGTCGTTATGGATTTATTCTACATAACACTATATCTTCCGAAACAAAATCAA
AATTTTAAAGGAAGATAATGATAATAATTAATTCTCGAATTAGCACAAAAGTTTTATTGT
ATCTAGACCTCGATTTATTAATAACTCCAATACCATATGCTTAGAGGAAACAAAAGCAGA
ACCGAACCACAACAAACTCATCTAATTCTTTCTATACAAACCGGAATTTCAATACAATAA
AAAAACATCTTCTTTTTGTTTGTTTGGTTTAGAATTGGTTCCTCTGAAAACAAAATGCTT
AATACAAAAAGAGGTACCTTTTTTTTCAGTCGATTTNTTTGTCTTG
   
Sequence Name 39-K102432-0022-795-H05C-NF33
GenBank Accession LN503308 [GenBank]
Sequencing primer gene specific primer, NF33: 5'-CAAGACAAAAACATCGACTGAAAA-3'
Sequence (A. th genome BLAST matches underlined)
>39-K102432-0022-795-H05C-NF33
GCATTTTGTTTTCGAGGAACAATTCTAAACCAACAAACAAAAAGAAGATGTTTTTTTATT
GTATTGAAATTCCGGTTTGTATAGAAAGAATTAGATGAGTTTGTTGTGGTTCGGTTCTGC
TTTTGTTTCCTCTAAGCATATGGTATTGGAGTTATTAATAAATCGAGGTCTAGATACAAT
AAAACTTTTGTGCTAATTCGAGAATTAATTATTATCATTATCTTCCTTTAAAATTTTGAT
TTTGTTTCGGAAGATATAGTGTTATGTAGAATAAATCCATAACGACGAAAGGAATAATAA
AAGGTTGTAATGAGTAAACTACAAACAGAAGAAAGGTATAAGATACATTTAGATACTAAT
CTTCCAAAAAACAAATCAAGATGTAGTTTTATAGAAAATCATATTCTTTCTTAGAAGAAA
ACAGATTTTTTTGTCTCATTCACTTGGAAAGAATCCTTCACTCACTTTCCCTTTAAGAAG
CAAGTCTCCTCCAATTGCAAGCCATCATACTCCAATTGTAAATGGCTTCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACA
TTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATT
ATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16