SimpleSearch - Line and FST details


Line specific information

 
Line ID 795H05
Vector Used pAC161
Line Availability only available from NASC (N476313)
Segregation Analysis 50:50:30
Confirmed for Hit At3g49360
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g49360

 
Sequence (A. th genome BLAST matches underlined)
>40-K024969-022-795-H05-8409
AATTGGAGTATGATGGCTTGCAATTGGAGGAGACTTGCTTCTTAAAGGGAAAGTGAGTGA
AGGATTCTTTCCAAGTGAATGAGACAAAAAAATCTGTTTTCTTCTAAGAAAGAATATGAT
TTTCTATAAAACTACATCTTGATTTGTTTTTTGGAAGATTAGTATCTAAATGTATCTTAT
ACCTTTCTTCTGTTTGTAGTTTACTCATTACAACCTTTTATTATTCCTTTCGTCGTTATG
GATTTATTCTACATAACACTATATCTTCCGAAACAAAATCAAAATTTTAAAGGAAGATAA
TGATAATAATTAATTCTCGAATTAGCACAAAAGTTTTATTGTATCTATGGGATCCTCCCT
ATAGTGAG
GenBank Accession BX949083 [GenBank]
Graphic View Graphic view of gene At3g49360
Predicted Position of Insertion Chr3:18304346 - go to primer design
BLAST e Value 3e-170
Hit Clone Code (BAC ID) F2K15
Hit Gene Code At3g49360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 6-phosphogluconolactonase 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40