Sequences from confirmation amplicon


Confirmation sequences for line 801E10 and hit At3g49260 are shown.
Line ID 801E10
Locus At3g49260 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:18262422
Primers used for PCR MZ46 - 8474, show primer details
   
Sequence Name 31-K024451-022-801-E10C-8409
GenBank Accession LN499996 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K024451-022-801-E10C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAAATGAGTGAGACATCCTCTCCTTCT
CAACTTAAGTCTCTCTGTGACTTCTCTCTCTCACCTCTTCTTATCTCTCTCGTTCTCTTT
CTCTAAACTTCAACAATCGCTTCTAATCGTTTGATCACATTGCACAAACATGTAAGTTCC
TCAATTAACATATATGTCTAACTTTTATGCATGTTGTTGTATGTATGACAATGTTATACA
TTTTTGGTTTTGGCTACAATTGGAATTGGTTTTGCTATTGGTGTAATTACAGCTATTTTT
GGGAATCTTTAAACATAATGTTTCAGTATTAATAGAGCTTATGATCAAAGAGTGTTGCCG
GAAATATGGGGAAGAAAGGGAGTGGTGGATGGTTCTCGACGGTGAAGAAGAAAGTCTTCA
AATCCTCTCCTAAA
   
Sequence Name 32-K024451-022-801-E10C-MZ46
GenBank Accession LN500420 [GenBank]
Sequencing primer gene specific primer, MZ46: 5'-CCTTGGAGTCTTTAGGAGAGGATT-3'
Sequence (A. th genome BLAST matches underlined)
>32-K024451-022-801-E10C-MZ46
TGAAGACTTTCTTCTTCACCGTCGAGAACCATCCACCACTCCCTTTCTTCCCCATATTTC
CGGCAACACTCTTTGATCATAAGCTCTATTAATACTGAAACATTATGTTTAAAGATTCCC
AAAAATAGCTGTAATTACACCAATAGCAAAACCAATTCCAATTGTAGCCAAAACCAAAAA
TGTATAACATTGTCATACATACAACAACATGCATAAAAGTTAGACATATATGTTAATTGA
GGAACTTACATGTTTGTGCAATGTGATCAAACGATTAGAAGCGATTGTTGAAGTTTAGAG
AAAGAGAACGAGAGAGATAAGAAGAGGTGAGAGAGAGAAGTCACAGAGAGACTTAAGTTG
AGAAGGAGAGGATGTCTCACTCATTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGA
TAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTA
ATTCGGAAATCTTTATTTC

Last Updated on 23.10.2014 13:25