SimpleSearch - Line and FST details


Line specific information

 
Line ID 801E10
Vector Used pAC106
Line Availability only available from NASC (N476858)
Segregation Analysis 50:37:30
Confirmed for Hit At3g49260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g49260

 
Sequence (A. th genome BLAST matches underlined)
>77-K023411-022-801-E10-8409
CGAATAAGCCATTTACAATTGAAATGAGTGAGACATCCTCTCCTTCTCAACTTAAGTCTC
TCTGTGACTTCTCTCTCTCACCTCTTCTTATCTCTCTCGTTCTCTTTCTCTAAACTTCAA
CAATCGCTTCTAATCGTTTGATCACATTGCACAAACATGTAAGTTCCTCAATTAACATAT
ATGTCTAACTTTTATGCATGTTGTTGTATGTATGACAATGTTATACATTTTTGGTTTTGN
NTATAATTGNAATTGATATTAATATTAAAAAAAATTAAGAAATTTGTAAAAAAAATAAAA
AATAATTTATATAAAATAATAAATGAAGTAAAAAGATAAAAATAGAGATAGAAAAAGAAA
AAAGGGGTGAATAGAAATGATGAAAGGTAAGAATGAAAAGGAGAGATAAGAAAAATAAAT
TAAGAAGAAAAAAAGAGGAAATTTAGAAGAATGGGGAAAGTTATAAAAATAAAGAAAAAA
AGAAGATAAGAAAATAAAGATTAAGAGATAGGATATGAGAGTAATGGGAAGGAAAGAAAA
AAGTGAGATA
GenBank Accession BX949649 [GenBank]
Graphic View Graphic view of gene At3g49260
Predicted Position of Insertion Chr3:18262445 - go to primer design
BLAST e Value 3e-68
Hit Clone Code (BAC ID) F2K15
Hit Gene Code At3g49260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation IQ-domain 21
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03