Sequences from confirmation amplicon


Confirmation sequences for line 815C12 and hit At3g54230 are shown.
Line ID 815C12
Locus At3g54230 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:20076062
Primers used for PCR BG18 - 8474, show primer details
   
Sequence Name 86-K101748-0022-815-C12C-8409
GenBank Accession LN514636 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>86-K101748-0022-815-C12C-8409
GCCATTTACATTGAATATATCCTGATGAATATCATATTGATAAATTTCATTTGCTTCGGT
TTATACTCTTTCTTCGGTTTGATTATTTTTTTTTAAGGTATTGTCGTCACCAAATCATGA
GTAGTTATCACTTTGTTTGAGACTCTAGAATCACCAAACAATGAGTAGTTCTTCCGGTAA
TTAAATATATGTAATTTCTGTTCTTAACAGATGGGTTTATACTCTAGTCCTGACAATGAA
ATTTACAGAACTTTCATCCAAAACAATGCACCAACCTGAAAGCAAGAGGTTCGCCGCGCA
AAATTGATACAGCCACAGATTGTACAGATCCAATCTGTGGGAACTATCATGTTTCGACTT
CCACCATAACTGCGTCTAGAAGCATGTTCCTGCCTACGGGACACACCAGCCCTACCAGTA
GGTTGGCTGCTACAACACACGCAATTTAGTG
   
Sequence Name 86-K101754-0022-815-C12C-BG18
GenBank Accession LN514637 [GenBank]
Sequencing primer gene specific primer, BG18: 5'-ACACTAAATTGCGTGTGTTGTAGC-3'
Sequence (A. th genome BLAST matches underlined)
>86-K101754-0022-815-C12C-BG18
GCAGGACATGCTTCTAGACGCAGTTATGGTGGAAGTCGAAACATGATAGTTCCCACAGAT
TGGATCTGTACAATCTGTGGCTGTATCAATTTTGCGCGGCGAACCTCTTGCTTTCAGGTT
GGTGCATTGTTTTGGATGAAAGTTCTGTAAATTTCATTGTCAGGACTAGAGTATAAACCC
ATCTGTTAAGAACAGAAATTACATATATTTAATTACCGGAAGAACTACTCATTGTTTGGT
GATTCTAGAGTCTCAAACAAAGTGATAACTACTCATGATTTGGTGACGACAATACCTTAA
AAAAAAATAATCAAACCGAAGAAAGAGTATAAACCGAAGCAAATGAAATTTATCAATATG
ATATTCATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCAAAAATGTAGATGTCCGCACGATTATT

Last Updated on 07.07.2016 14:16