SimpleSearch - Line and FST details


Line specific information

 
Line ID 815C12
Vector Used pAC106
Line Availability only available from NASC (N478180)
Segregation Analysis 50:19:13
Confirmed for Hit At3g54230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g54230

 
Sequence (A. th genome BLAST matches underlined)
>91-K025605-022-815-C12-8409
NNNNAGTAGTAATTCGGACATGAGCCATTTACAATTGAATATATCCTGATGAATATCATA
TTGATAAATTTCATTTGCTTCGGTTTATACTCTTTCTTCGGTTTGATTATTTTTTTTTAA
GGTATTGTCGTCACCAAATCATGAGTAGTTATCACTTTGTTTGAGACTCTAGAATCACCA
AACAATGAGTAGTTCTTCCGGTAATTAAATATATGTAATTTCTGTTCTTAACAGATGGGT
TTATACTCTAGTCCTGACAATGAAATTTACAGAACTTTCATCCAAAACAATGCACCAACC
TGAAAGCAAGAGGTTCGCCGCGCAAAATTGATACAGCCACAGATTGTATGGGATCCTCCC
TATAGTGAG
GenBank Accession CR399130 [GenBank]
Graphic View Graphic view of gene At3g54230
Predicted Position of Insertion Chr3:20076114 - go to primer design
BLAST e Value 2e-127
Hit Clone Code (BAC ID) F24B22
Hit Gene Code At3g54230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation suppressor of abi3-5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR399131 [GenBank]


Last Updated on 07.07.2016 14:03