Sequences from confirmation amplicon


Confirmation sequences for line 815H04 and hit At3g50376 are shown.
Line ID 815H04
Locus At3g50376 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:18685926
Primers used for PCR DR53 - 8474, show primer details
   
Sequence Name 19-K035539-022-815-H04C-DR53
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, DR53: 5'-GCTTATCCATTCGACTCTTGTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K035539-022-815-H04C-DR53
TAAAAGAAAGTACATTTCGATAAAACAACAAATTACCATCCCTCC
   
Sequence Name 04-K035539-022-815-H04C-8409
GenBank Accession LN487823 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>04-K035539-022-815-H04C-8409
AAGCCTTTACAATTGAAATATCCTGTAGATGTTCATGTCAGTTCATCACCATCTCTGAAA
AACTACTCATACTTGGTGATCTGCAACAAGTTGCTCTTGTCATGAGGCCAAACATCACTA
GTATCATCCACAATTACGACACTTTGCTTATCAGCCACAACAAGCTCAAGTGTCTTCTTA
CTAGGACTTTCTTTACTGGTTATGACTCGATCTCCAAAGTAAACTTTGTCCGGATCAATC
AACTTCAACACGGTCTGTGCGTAAGTGAATAACCCCATTGTGTAAACATGCATAGTGAAA
TGCTCGTTGGCTCCTAATAGAAATTCATGAAGAAAAGGTCGAAGTTTAATGATATACTCA
TTGGAATGGCCTTTGTTGAATCTCCATAAATCTAGCCTTGAATCGACTTGTTCGAGTAGA
TACTTCTCCTTTTTAGAAATTTACGAAACAAGAGTCG

Last Updated on 23.10.2014 13:25