SimpleSearch - Line and FST details


Line specific information

 
Line ID 815H04
Vector Used pAC106
Line Availability only available from NASC (N478232)
Segregation Analysis 60:13:12
Confirmed for Hit At3g50376
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g50376

 
Sequence (A. th genome BLAST matches underlined)
>32-K025643-022-815-H04-8409
NNTTTTCGAGGATATCCCGGAAGNAGCCATTTACATTGAATATATCCTGGTAGATGTTCA
TGTCATTTTCATCACCAGTCACTGAAAAACTACTCATACATTGGTGATCTGCAACAAGTT
GCTCTTGTCATGAGGCCAAACATCACTAGTATCATCCACAATTACGACACTTTGCTTATC
AGCCACAACAAGCTCAAGTGTCTTCTTACTAGGACTTTCTTTACTGGTTATGACTCGATC
TCCAAAGTAAACTTTGTCCGGATCAATCAACTTCAACACGGTCTGTGCGTAAGTGAATAA
CCCCATTGTGTAAACATGCATAGTGAAATGCTCGTTGGCTCCTAATAGAAATTCATGAAG
AAAAGGTCGAAGTTTAATGATATACTCATTGGAATGGCCTTTGTTGAATCTCCATAAATC
TAGCCTTGAATCGACTTGTTCGAGTAGATACTTCTCCTTTTTAGAAATTTACGAAACAAG
AGTCGAATGGATAAGCGTGTGGTCCAAATCAAGGACTAGGTGAAGCTTCTTCTCCGTCTT
CTTCCCCTTCTTCTTCTCATCGAGA
GenBank Accession CR399193 [GenBank]
Graphic View Graphic view of gene At3g50376
Predicted Position of Insertion Chr3:18685936 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11C1
Hit Gene Code At3g50376 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03