Sequences from confirmation amplicon


Confirmation sequences for line 818G06 and hit At3g05260 are shown.
Line ID 818G06
Locus At3g05260 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:1498602
Primers used for PCR MA72 - 8474, show primer details
   
Sequence Name 18-K102512-0022-818-G06C-8409
GenBank Accession LN494252 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K102512-0022-818-G06C-8409
ATTTACAATTGAATATATCCTGTCCGGATGAATCGACTCACATATGTGTCCGGATGAAGT
CAAAGACTCAGGGATAGGTAAAGCAGTGTGTCACTGCTATGCACTTGAAGGAGCGAGCGT
GGCTTTCACGTACGTTAAAGGTAGAGAGGACAAAGACGCAGAAGAAACGCTGCGTTTGCT
TCACGAGGTTAAGACAAGGGAAGCTAAAGAGCCGATCATGATCGCTACTGATTTAGGGTT
TGAAGAGAATTGCAAGAGGGTCGTTGAGGAAGTTGTGAACTCCTTTGGACGCATCGATGT
GCTTGTGAATTGTGCAGCTGAGCAGCATGAGGTTTCCATTGAGGATATCGATGAGGCTAG
GCTTGAGAGAGTGTTCCGTACCAACATCTTCTCGCAGTTTTTCTTGGTTAAGTGAGTAAA
AAAAAAAAACTGAAACTCGAACTTAGGTTCTGAAACTAATTGATCCGGTTAGAGTTAATT
GGTCGTAATTTATTGTAAATATGCGTTAAAGCACATGAAGGAAGGGAGCAGCATCATCAA
TACGACGTCGGTTGTTGCATACGCAGGAAACTCAAGCTTACTAGAGTACACAGCTCGAAA
AGGGA
   
Sequence Name 37-K102513-0022-818-G06C-MA72
GenBank Accession LN502571 [GenBank]
Sequencing primer gene specific primer, MA72: 5'-GCTCCTTTCGTAGCTGTGTACTCT-3'
Sequence (A. th genome BLAST matches underlined)
>37-K102513-0022-818-G06C-MA72
ACACCGACGTCGTATTGATGATGCTGCTCCCTTCCTTCATGTGCTTTAACGCATATCTAC
AATAAATTACGACCAATTAACTCTAACCGGATCAATTAGTTTCAGAACCTAAGTTCGAGT
TTCAGTTTTTTTTTTTTACCCACTTAACCAAAAAAAACTGCGAGAAAATGTTGGTACGGA
ACACTCTCTCAAGCCTAGCCTCATCGATATCCTCAAGGGAAACCTCAGGCGGCTCAGCTG
CACAATTCACAAGCACATCGATGCGTCCAAAGGAGTTCACAACTTCCTCAACGACCCTCT
GGCAATTCTCTTCAAACCCTAAATCAGTAGCGATCAGGATCGGCTCTTTAGCTTCCCTTG
TCTTAACCTCGGGAAGCAAACGCAGCGTTTCTTCGGCGTCTTTGTCCTCTCTACCTTTAA
CGTACGTGAAAGCCACGCTCGCTCCTTCAAGTGCATAGCAGTGACACACTGCTTTACCTA
TCCCGGAGTCTTTGACTTCATCCGGACACATATGTGAGTCGATTCATCCGGACAGGATAT
ATTCAATTGTAAATGGCTTCAGGTCCGGGAAATCTACATGGATCACCAATGAGTATGATG
GTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGAT
GTCCGCGGCGTTATTATAAAATGAAAGTACTTTTTGATAAAACGACAAATTACGATCCGT
CGTATTTATGGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGAC

Last Updated on 23.10.2014 13:25