SimpleSearch - Line and FST details


Line specific information

 
Line ID 818G06
Vector Used pAC106
Line Availability only available from NASC (N478510)
Segregation Analysis 50:22:21
Confirmed for Hit At3g05260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g05260

 
Sequence (A. th genome BLAST matches underlined)
>47-K025607-022-818-G06-8409
AGCCATTTACATTGAATATATCCTGACACGATTAATCGACTCTACTTATGTGTCCGGATG
AAGTCCATACTCATGGATAGGTAAAGCAGTGTGTCACTGCTATGCACTTGAAGGAGCGAG
CGTGGCTTTCATGTATGGGATCCTCCCTATAGTGAGACCCATGAGTGATCCCCATGTCAC
TTTTATACATCATCCGTCTGATGGCGATGCTACAAAACCACTCGATCCCTGACATCACCC
TACCAACCTGGTTGGAGCCCAGTATGATATCCTAGTATTTGTACGCAGGTATGGTATCCT
CCCTATATTGAGTATCTTTTTCTTANTCCTTATAATATAAAATTTATTATA
GenBank Accession CR399508 [GenBank]
Graphic View Graphic view of gene At3g05260
Predicted Position of Insertion Chr3:1498630 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) T12H1
Hit Gene Code At3g05260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR399508 [GenBank]


Last Updated on 31.08.2016 09:40