Sequences from confirmation amplicon


Confirmation sequences for line 851F10 and hit At3g21380 are shown.
Line ID 851F10
Locus At3g21380 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:7528839
Primers used for PCR NR85 - 8474, show primer details
   
Sequence Name 40-K102592-0022-851-F10C-8409
GenBank Accession LN503667 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K102592-0022-851-F10C-8409
ATTTACATTGCGGAATGTAGTTTGATTAACTGACACTTAATTACTAAATGAAAAGAAAAA
ATGATGGGTCCTGCTAGGTCTAATAATAGCATATAAAAATGAATTAGGGCTAGGAAAATT
TTGGTCTACTATATTTTTGTTTATAATGATTTATTTATTGTATACTTTGATCGAACTAAT
GTAATATATTTGTTTTTGTAGGTGAGCTTGAGCCCAGACGAGTACATAACAGATGTTACT
GGCTACTACAAAACTACAGGGGCTGAAGATGCTATAGCAGCATTGGCTTTTAAGACCAAC
AAAACTGAATATGGTCCTTACGGAAACAAAACAAGGAACCAATTCTCCATTCATGCTCCT
AAAGATAATCAGATAGCTGGTTTCCAAGGAATTAGCAGCAATGTTCTCAACTCTATTGAC
T
   
Sequence Name 40-K102593-0022-851-F10C-NR85
GenBank Accession LN503668 [GenBank]
Sequencing primer gene specific primer, NR85: 5'-AGCAAAGTGGACGTCAATAGAGTT-3'
Sequence (A. th genome BLAST matches underlined)
>40-K102593-0022-851-F10C-NR85
GCTATCTGATATCTTTAGGAGCATGAATGGAGAATTGGTTCCTTGTTTTGTTTCCGTAAG
GACCATATTCAGTTTTGTTGGTCTTAAAAGCCAATGCTGCTATAGCATCTTCAGCCCCTG
TAGTTTTGTAGTAGCCAGTAACATCTGTTATGTACTCGTCTGGGCTCAAGCTCACCTACA
AAAACAAATATATTACATTAGTTCGATCAAAGTATACAATAAATAAATCATTATAAACAA
AAATATAGTAGACCAAAATTTTCCTAGCCCTAATTCATTTTTATATGCTATTATTAGACC
TAGCAGGACCCATCATTTTTTCTTTTCATTTAGTAATTAAGTGTCAGTTAATCAAACTAC
ATTCCGCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCTACATTCA

Last Updated on 07.07.2016 14:16