SimpleSearch - Line and FST details


Line specific information

 
Line ID 851F10
Vector Used pAC161
Line Availability only available from NASC (N481670)
Segregation Analysis 50:24:19
Confirmed for Hit At3g21380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g21380

 
Sequence (A. th genome BLAST matches underlined)
>78-K025843-022-851-F10-8409
TATTCGGTCAGAGATCAGATTACATATGCGAGACTGACCATAGTATACCCGTTGCAACAT
CTCATAAATTGAAAGATGTAGTATATATGTCATAAGGTCGTGAATAGTATGGTAATCCTC
TGTATTATGAGCTAGGAAAATTTTGGTCTACTATATTTTTGTTTATAATGATTTATTTAT
TGTATACTTTGATCGAACTAATGTAATATATTTGTTTTTGTAGGTGAGCTTGAGCCCAGA
CGAGTATGGGATCCTCCCTATAGTGAGNNNNNGGGTTTTTTCCGNANTCCCAGAGGGACT
CATGGGCCCGCTCTTTTTATTTTTTTAGTAAAAATGGGGGAAAAGGAA
GenBank Accession CR402045 [GenBank]
Graphic View Graphic view of gene At3g21380
Predicted Position of Insertion Chr3:7528848 - go to primer design
BLAST e Value 3e-59
Hit Clone Code (BAC ID) MHC9
Hit Gene Code At3g21380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mannose-binding lectin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR816674 [GenBank]


Last Updated on 07.07.2016 14:03