Sequences from confirmation amplicon


Confirmation sequences for line 853E12 and hit At4g39000 are shown.
Line ID 853E12
Locus At4g39000 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:18173263
Primers used for PCR NR83 - 8474, show primer details
   
Sequence Name 28-K102512-0022-853-E12C-8409
GenBank Accession LN498791 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K102512-0022-853-E12C-8409
ATTTCCCGGATATAGATTTCATTTTGTATAATACATACCGGTATCAAGAATTTGTTTCAC
CAATTTTGTCATAATAGGACAGGAATCAAATTGGATATCTTCCCTGACAAGATAACAATA
TGTGTTGATTAGTTTCTTCTTCTGTAATTATTCTTTTTACGAGACCACGATTTTTAATGG
AAAATATTAAGAATATCTTTTTATTATGTACACACCAACAACACAAGATTAATATTGTAT
AGGTCGGTGAAGTACAACCGGACCACGATTGTTGGGAAAGACCGGAAGATATGGACACGC
CACGAACCGCTTTCGCCTTAGATGCACCATATCCAGCCTCCGATTTAGCGGGAGAAATCG
CAGCAGCTTTAGCAGCCGCTTCAATTGCATTCAAACAAGCAAATCCTAAGTATTCCGCAA
TATTACTCAATAAAGCCGTACAAACGTTTCAGTACGCAGATTCACATCGAGGTTTCTTAC
   
Sequence Name 47-K102513-0022-853-E12C-NR83
GenBank Accession LN506164 [GenBank]
Sequencing primer gene specific primer, NR83: 5'-TGTAAGAACCTCGATGTGAATCTG-3'
Sequence (A. th genome BLAST matches underlined)
>47-K102513-0022-853-E12C-NR83
CTTTTGAGTATATTGCGGAATACTTAGGATTTGCTTGTTTGAATGCAATTGAAGCGGCTG
CTAAAGCTGCTGCGATTTCTCCCGCTAAATCGGAGGCTGGATATGGTGCATCTAAGGCGA
AAGCGGTTCGTGGCGTGTCCATATCTTCCGGTCTTTCCCAACAATCGTGGTCCGGTTGTA
CTTCACCGACCTATACAATATTAATCTTGTGTTGTTGGTGTGTACATAATAAAAAGATAT
TCTTAATATTTTCCATTAAAAATCGTGGTCTCGTAAAAAGAATAATTACAGAAGAAGAAA
CTAATCAACACATATTGTTATCTTGTCAGGGAAGATATCCAATTTGATTCCTGTCCTATT
ATGACAAAATTGGTGAAACAAATTCTTGATACCGGTATGTATTATACAAAATGAAATCTA
TATCCGGGAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGT
CAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGT
CCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCG
TATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTG
TCTACATTCAC

Last Updated on 07.07.2016 14:16