SimpleSearch - Line and FST details


Line specific information

 
Line ID 853E12
Vector Used pAC161
Line Availability only available from NASC (N481852)
Segregation Analysis 50:41:34
Confirmed for Hit At4g39000
Parent of DUPLO pair none
Parent of pair(s) 5603, 5719, 5727, 10378, 56077, 91142, 91143, 91147, 91148

Gene hit At4g39000

 
Sequence (A. th genome BLAST matches underlined)
>93-K025845-022-853-E12-8409
AATGTGTTTGACCGATTTTGCCATAGGAAGACAGGAATCAGATTGTATATCTTCCCTGAA
AAGATAACAATATGTGTTGATTAGTTTCTTCTTCTGTAATTATTCTTTTTACGAGACCAC
GATTTTTAATGGAAAATATTAAGAATATCTTTTTATTATGTATGGGATCCTCCCTATAGT
GAG
GenBank Accession CR402264 [GenBank]
Graphic View Graphic view of gene At4g39000
Predicted Position of Insertion Chr4:18173258 - go to primer design
BLAST e Value 7e-63
Hit Clone Code (BAC ID) F19H22
Hit Gene Code At4g39000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glycosyl hydrolase 9B17
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40