SimpleSearch - Line and FST details


Line specific information

 
Line ID 853E12
Vector Used pAC161
Line Availability only available from NASC (N481852)
Segregation Analysis 50:41:34
Parent of DUPLO pair none
Parent of pair(s) 5603, 5719, 5727, 10378, 56077, 91142, 91143, 91147, 91148

Gene hit At4g39000

 
Sequence (A. th genome BLAST matches underlined)
>93-K025845-022-853-E12-8409
AATGTGTTTGACCGATTTTGCCATAGGAAGACAGGAATCAGATTGTATATCTTCCCTGAA
AAGATAACAATATGTGTTGATTAGTTTCTTCTTCTGTAATTATTCTTTTTACGAGACCAC
GATTTTTAATGGAAAATATTAAGAATATCTTTTTATTATGTATGGGATCCTCCCTATAGT
GAG
GenBank Accession CR402264 [GenBank]
Graphic View Graphic view of gene At4g39000
Predicted Position of Insertion Chr4:18173258 - go to primer design
BLAST e Value 7e-63
Hit Clone Code (BAC ID) F19H22
Hit Gene Code At4g39000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glycosyl hydrolase 9B17
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03