Sequences from confirmation amplicon


Confirmation sequences for line 861A07 and hit At1g77730 are shown.
Line ID 861A07
Locus At1g77730 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29215275
Primers used for PCR JF19 - 8474, show primer details
   
Sequence Name 46-K102175-0022-861-A07C-8409
GenBank Accession LN505820 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K102175-0022-861-A07C-8409
TTACATTGCAGACTCTTCGTGCCCGTGAATACGTGAATCTCTTGCCATCTGATATGCTTT
GTCCAATCGATGAAACCTGAAAAACATCAAAAAATCCGAAAATTACATATGTAATTTGGG
TATGTATTTTGTAAATCGAAAAGGTTGGAGTACATTTGAATAATCTTGGAAACAAATGGA
GCACTTATAAATATGGATGAAGTCTCAAATCATATATGCAATTGTGCGTTTTAGATCATT
TTAAGTGTTTTGGGGTACATTTGAAAACATTGTAAACTACAGAGGGTATACTTTTAGATT
AATTTACCCAAATTAAGGTTGTACTAATATTTTTAAAATGTATGCGTTGTATTTGAAACG
TATGTAAAATACAGGGGCGTTCTGAAATAAATCAAAACCTTGAGGTGAATTTGGCCGAGA
GGTTTCCCGGGGCTATGAACATCACCGCGTTTGCTATGTCGGCAAATAAACCGTAAAGAT
TCGCCGCCGATCAGTTTAGATCTCCGATCCATCTCAACGGAGAGAGATATTTTATCGGGA
C
   
Sequence Name 46-K102179-0022-861-A07C-JF19
GenBank Accession LN505821 [GenBank]
Sequencing primer gene specific primer, JF19: 5'-GGTCCCGATAAAATATCTCTCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K102179-0022-861-A07C-JF19
GCGGCGAATCTTTCGGTTTATTTGCCGACATAGCAAACGCGGTGATGTTCATAGCCCCGG
GAAACCTCTCGGCCAAATTCACCTCAAGGTTTTGATTTATTTCAGAACGCCCCTGTATTT
TACATACGTTTCAAATACAACGCATACATTTTAAAAATATTAGTACAACCTTAATTTGGG
TAAATTAATCTAAAAGTATACCCTCTGTAGTTTACAATGTTTTCAAATGTACCCCAAAAC
ACTTAAAATGATCTAAAACGCACAATTGCATATATGATTTGAGACTTCATCCATATTTAT
AAGTGCTCCATTTGTTTCCAAGATTATTCAAATGTACTCCAACCTTTTCGATTTACAAAA
TACATACCCAAATTACATATGTAATTTTCGGATTTTTTGATGTTTTTCAGGTTTCATCGA
TTGGACAAAGCATATCAGATGGCAAGAGATTCACTGTATTCACGGGCACGAAGAGTCTGC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCACG
Primers used for PCR 71wl - 8474, show primer details
   
Sequence Name 45-K118446-0022-861-A07C-71wl
GenBank Accession LN505686 [GenBank]
Sequencing primer gene specific primer, 71wl: 5'-TCATGTTCATTACGTAGCGTTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K118446-0022-861-A07C-71wl
CCACTACGTTATATTATTGCTTATATTATTATCTATTGAAAACGTTTTAGAAACTTCGTA
AGATTACTTTGAATGTCCACAAACTGAATTAGCATAACATTGACTTCAATCATTATATAT
TTATACTAAACCAAAGATAAAAAATTGCAAAATACTCATACAAGGTCATGTCACTGCATT
TGAAAATCTAAATGGGCCGATATCTTTCAAATAAATTACACATAGGCTTTCACTAAATGG
CCCATAAAACACATGGGATTCTAAATACTCCACTCACACCAAAACAATAGTATAGAAGAG
CCATATGCCCATATCAAATCGTGGATATTTCATTATTATTGCATAGTATACTTTAATTTA
AACTGATATTAAATCAAATGTAATTATTTCATGAAAAACTTTGGTTACTGGGTCTTATAG
GTGAGTTACTGACGTTCTTGAGAGAATCTATAAGATGATATTGGTACCGTTTTAGAGACA
TAACCTCATCATGCAATGCTAAGAAATTGTTCTTCATTATGTCTTCGCAATCTTTGATGA
TTGTCTCATCTACCTCTTCTTCCATTAATCTCTGCCTTAGCTTATCGGTCGAGACTGAGA
CATTAGTCGTCGATGCCATTAGTTCTTCGTTTGACATTCTTGGAAACGTTTCTTTACAGC
TTTCAATGCTTCGATCCTCTTGGACAATTCAATTGTAATGGCTTCATGTCCGGGAAACTA
CATGGATCACAATGAGTATGATGGTAATATGGAGAAAAAGAAGAGTATTACCATTTTTTT
TCATTCA
   
Sequence Name 05-K118445-0022-861-A07C-8409
GenBank Accession LN488556 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K118445-0022-861-A07C-8409
GCCATTTACATTGAATTGATCCAGAGGATCGAAGCATTGAAAGCTGTTAAAGAAACGTTT
CCAAGAATGTCAAACGAAGAACTAATGGCATCGACGACTAATGTCTCAGTCTCGACCGAT
AAGCTAAGGCAGAGATTAATGGAAGAAGAGGTAGATGAGACAATCATCAAAGATTGCGAA
GACATAATGAAGAACAATTTCTTAGCATTGCATGATGAGGTTATGTCTCTAAAACGGTAC
CAATATCATCTTATAGATTCTCTCAAGAACGTCAGTAACTCACCTATAAGACCCAGTAAC
CAAAGTTTTTCATGAAATAATTACATTTGATTTAATATCAGTTTAAATTAAAGTATACTA
TGCAATAATAATGAAATATCCACGATTTGATATGGGCATATGGCTCTTCTATACTATTGT
TTTGGTGTGAGTGGAGTATTTAGAATCCCATGTGTTTTATGGGCCATTTAGTGAAAGCCT
ATGTGTAATTTATTTGAAAGATATCGGCCCATTTAGATTTTCAAATGCAGTGACATGACC
TTGTATGAGTATTTTGCAATTTTTTATCTTTGGTTTAGTATAAATATATAATGATTGAAG
TCAATGTTATGCTAATTCAGTTTGTGGACATTCAAAGTAATCTTACGAAGTTTCTAAAAC
GTTTTCAATAGATAATAATATAAGCAATAATATAACGTAGTGGTTAACTATATAGGCACC
GCCNACAAATAATCTAATGCATGAAACGCT

Last Updated on 07.07.2016 14:16