SimpleSearch - Line and FST details


Line specific information

 
Line ID 861A07
Vector Used pAC161
Line Availability only available from NASC (N482567)
Segregation Analysis 50:37:29
Confirmed for Hit At1g77730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77730

 
Sequence (A. th genome BLAST matches underlined)
>49-K025974-022-861-A07-8409
TGAGCCTTTACAATTGAATTGATCCCGAGGATCGAAGCATTGAAAGCTGTTAAAGAAACG
TTTCGCAGAATGTCAAACGAAGAACTAGTGGCATCGACGACTAATGTCTCAGTCTCGACC
GATAAGCTAAGGCAGAGATTAATGGAAGAAGAGGTAGATGAGACAATCATCAAAGATTGC
GAAGACATAATGAAGAACAATTTCTTAGCATTGCATGATGAGGTTATGTCTCTAAAACGG
TATGGGATCCTCCCTATAGTGAG
GenBank Accession CR403145 [GenBank]
Graphic View Graphic view of gene At1g77730
Predicted Position of Insertion Chr1:29215275 - go to primer design
BLAST e Value 1e-110
Hit Clone Code (BAC ID) T32E8
Hit Gene Code At1g77730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pleckstrin homology (PH) domain superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR403146 [GenBank]


Last Updated on 31.08.2016 09:40