Sequences from confirmation amplicon


Confirmation sequences for line 868E06 and hit At5g15110 are shown.
Line ID 868E06
Locus At5g15110 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:4897493
Primers used for PCR JF16 - 8474, show primer details
   
Sequence Name 44-K102502-0022-868-E06C-8409
GenBank Accession LN505139 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>44-K102502-0022-868-E06C-8409
TTTACAATTGAATAATCCTGGAACCCATGTAGAAACACTGGAACTGGAGATCTGATAAAG
ATGTATTCATGAACGGTGCTTATTTCAGACAATCTGGTAATCCTCAATACAAATGTGCAC
ACACAAGACAACAAATGATCAAACCGAAAAATGGATTGGCTGTTTCAAAGCTGACCAAAT
ATGCCGGAGCACTTGATTGCAGAGTCGGGAGACGCTGTTAGAAAATTTCTTTTAATTTAC
TATTGATGTTTTAAGGGAAAGACAATTTTTTCAACATTTTGATTTTTTGCTTCTAATCTA
GTTCAGGAAATAAATAATTTCAGGGGTGAAAATGATTAAAAAAAAATTCTAATTTGTAAA
GTTATTTTTTGTGTTATGAAAACAAGTTATATAAAGAGTAAGCCATAACAGCTGGTTCTT
GTAATACATAATTCACATTTTGTTTGTTAAACAACCAAAACTAAATCATCAAATACTTTT
TTTTGGATTCAAATCTGCATAAAACATGCTGGTAAAACAAAA
   
Sequence Name 44-K102503-0022-868-E06C-JF16
GenBank Accession LN505140 [GenBank]
Sequencing primer gene specific primer, JF16: 5'-TTTGTTTACCAGCATGTTTTATGC-3'
Sequence (A. th genome BLAST matches underlined)
>44-K102503-0022-868-E06C-JF16
ACAAAACATTTGATGATTTAGTTTTGGTTGTTTAACAACAAAATGTGAATTATGTATTAC
AAGAACCAGCTGTTATGGCTTACTCTTTATATAACTTGTTTTCATAACACAAAAAATAAC
TTTACAAATTAGAATTTTTTTTTAATCATTTTCACCCCTGAAATTATTTATTTCCTGAAC
TAGATTAGAAGCAAAAAATCAAAATGTTGAAAAAATTGTCTTTCCCTTAAAACATCAATA
GTAAATTAAAAGAAATTTTCTAACAGCGTCTCCCGACTCTGCAATCAAGTGCTCCGGCAT
ATTTGGTCAGCTTTGAAACAGCCAATCCATTTTTCGGTTTGATCATTTGTTGTCTTGTGT
GTGCACATTTGTATTGAGGATTACCAGATTGTCTGAAATAAGCACCGTTCATGAATACAT
CTTTATCAGATCTCCAGTTCCAGTGTTTCTACATGGGTTCCAGGATATATTCAATTGTAA
ATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAG
AAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTT
ATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGG
CGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25