SimpleSearch - Line and FST details


Line specific information

 
Line ID 868E06
Vector Used pAC161
Line Availability only available from NASC (N483286)
Segregation Analysis 50:19:10
Confirmed for Hit At5g15110
Parent of DUPLO pair none
Parent of pair(s) 6538, 6540, 6549, 6554, 85683, 85704, 85710, 85711, 85713

Gene hit At5g15110

 
Sequence (A. th genome BLAST matches underlined)
>45-K026080-022-868-E06-8409
NNTTTCGTAGTAATTCGGACATGAGCCTTTACATTGAATATATCCTGGAACCCATGTAGA
AACACTGGAACTGGAGATCTGATAAAGATGTATTCCTGAACGGTGCTTATTTCACACAAT
CTGGTAATCCTCAATACCAATGTGCACACACAAGACAACAAATGATCAAACCGAAAAATG
GATTGGCTGTTTCAAAGCTGACCAAATATGCCGGAGCACTTGATTGCAGAGTCGGGAGAC
GCTGTTAGAAAATTTCTTTTAATTTACTATTGATGTTTTAAGGGAAAGACAATTTTTTCA
ACATTTTGATTTTTTGCTTCTAATCTAGTTCAGGAAATAAATAATTTCAGGGGTGAAAAT
GATTAAAAAAAAATTCTAATTTGTAAAGTTATTTTTTGTGTTATGAAAACAAGTTATATA
AAGAGTAAGCCATAACAGCTGGTTCTTGTAATACATAATTCACATTTTGTTTGTTAAACA
ACCAAAACTAAATCATCAAATACTTTTTTTTGGATTCAAATCTGCATAAAACATGCTGGT
AAACAAAAATATAATGATAAT
GenBank Accession CR404097 [GenBank]
Graphic View Graphic view of gene At5g15110
Predicted Position of Insertion Chr5:4897493 - go to primer design
BLAST e Value 2e-106
Hit Clone Code (BAC ID) F2G14
Hit Gene Code At5g15110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectate lyase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR404098 [GenBank]


Last Updated on 07.07.2016 14:03