Sequences from confirmation amplicon


Confirmation sequences for line 872F08 and hit At4g40100 are shown.
Line ID 872F08
Locus At4g40100 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:18583883
Primers used for PCR JD18 - 8474, show primer details
   
Sequence Name 75-K102874-0022-872-F08C-8409
GenBank Accession LN513221 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>75-K102874-0022-872-F08C-8409
GCCATTTACATTGAATATCAAGATTTAATAGTTAGTTACCATAAATAATCCCATCAAATC
ACAGAATAAACAGAAAAAACAAAAGTTAATATTCGCTTTGAAACTCCATTGCTCAAACCT
ATAATATCTAACTCATCAAGAAGTGATATACCATGTAGCATGACAATCACCCAAATCTAT
CAACAATCTCAGCTCATAGTATATTTTCTCAGGGTTAACGATGCAACAATACAAGATCGG
AAACTCACGGTGTTGCCACGTGTTCCCGGCAAGGCTCTCTGCCTTCATTGCAGCTTCTCC
AACCCTCCTTCCCCATCTCCCAAGCACACCTTTCACAGATTCCATCGTTTCTGATCCANT
TTCAAA
   
Sequence Name 75-K102875-0022-872-F08C-JD18
GenBank Accession LN513222 [GenBank]
Sequencing primer gene specific primer, JD18: 5'-CTTTGAAATTGGATCAGAAACGAT-3'
Sequence (A. th genome BLAST matches underlined)
>75-K102875-0022-872-F08C-JD18
GGGAGGAGGGTTGGAGAACTGCAATGAAGGCAGAGAGCCTCCCCTAAAACACGTGGCAAC
ACCGTGAGTTTCCGATCTTGTATTGTTGCATCGTTAACCCTGAGAAAATATACTATGAGC
TGAGATTGTTGATAGATTTGGGTGATTGTCATGCTACATGGTATATCACTTCTTGATGAG
TTAGATATTATAGGTTTGAGCAATGGAGTTTCAAAGCGAATATTAACTTTTGTTTTTTCT
GTTTATTCTGTGATTTGATGGGATTATTTATGGTAACTAACTATTAAATCTTGATATTCA
ATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAA
TATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCG
CAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTAT
TTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCT
ACATTCACGTCCAAATGG

Last Updated on 23.10.2014 13:25