SimpleSearch - Line and FST details


Line specific information

 
Line ID 872F08
Vector Used pAC161
Line Availability only available from NASC (N483684)
Segregation Analysis 50:27:20
Confirmed for Hit At4g40100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g40100

 
Sequence (A. th genome BLAST matches underlined)
>62-K026084-022-872-F08-8409
CCATTTACATTGAATATCAAGATTTAATAGTTAGTTACCATAAATAATCCCATCAAATCA
CAGAATAAACAGAAAAAACAAAAGTTAATATTCGCTTTGAAACTCCATTGCTCAAACCTA
TAATATCTAACTCATCAAGAAGTGATATACCATGTAGCATGACAATCACCCAAATCTATC
AACAATCTCAGCTCATAGTATATTTTCTCAGGGTTAACGATGCAACAATACAAGATCGGA
AACTCACGGTGTTGCCACGTGTTCCCGGCAAGGCTCTCTGCCTTCATTGCAGCTTCTCCA
ACCCTCCTTCCCCATCTCCCAAGCACACCTTTCACAGATTCCATCGTTTCTGATCCAATT
TCAAAGAGATTTTCCAACGGTTACTTACACATCTCATAGCATAAACCAAAAAGATACTGA
CACAGTTTTAAACACAGTATGGGATCCTCCCTAATAGTGAG
GenBank Accession CR404714 [GenBank]
Graphic View Graphic view of gene At4g40100
Predicted Position of Insertion Chr4:18583883 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5J17
Hit Gene Code At4g40100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAM domain family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR404714 [GenBank]


Last Updated on 31.08.2016 09:40