Sequences from confirmation amplicon


Confirmation sequences for line 874A06 and hit At1g29270 are shown.
Line ID 874A06
Locus At1g29270 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:10230618
Primers used for PCR KQ88 - 8474, show primer details
   
Sequence Name 07-K101499-0022-874-A06C-8409
GenBank Accession LN489208 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K101499-0022-874-A06C-8409
CATTTACAATTGAATATGATCCACTTTTTCTATGATCAAAGTTATATGTGGTGTTGTTAT
ATAAAAATATTCGATTACATTTTGGTAAAAAAACTCCTCAATTTTTCATAGGATAGACAA
AAGTTTCTCAATATGACTATGTAATATACATAGAAGAGCTTCACCAATGATAAAGAAATA
GATGAAAGGAGAAACCTGAAATTGGTGCAAAGATTCTTTTTTGGTAATCTTGAGATCTTC
ATATTCTCTCTGCAAAGCTTCTATCTCGAGTTTGAGCATGGCTATGTATAGAAGAGCTTC
CCTAATAACCATGCTCTGTTCATGTATACTCTGCATAATAACTCATTGGCTTTAAACATT
TTAAAATAGTAGAATCATCAAGTGATATGAACATATATTTATGTTGTACATACAAATTTA
AAGTGGGTGAGATTTTTAAGAAAATGAGGTTTCCCTTGGCTTGCCCTCTTCTTTTGTTCA
CTAGCCACCATCACTTTC
   
Sequence Name 07-K101503-0022-874-A06C-KQ88
GenBank Accession LN489209 [GenBank]
Sequencing primer gene specific primer, KQ88: 5'-ATTGAGAAAGTGATGGTGGCTAGT-3'
Sequence (A. th genome BLAST matches underlined)
>07-K101503-0022-874-A06C-KQ88
CAGCCAGGGAACTCATTTTCTTAAAATCTCACCCACTTTAAATTTGTATGTACAACATAA
ATATATGTTCATATCACTTGATGATTCTACTATTTTAAAATGTTTAAAGCCAATGAGTTA
TTATGCAGAGTATACATGAACAGAGCATGGTTATTAGGGAAGCTCTTCTATACATAGCCA
TGCTCAAACTCGAGATAGAAGCTTTGCAGAGAGAATATGAAGATCTCAAGATTACCAAAA
AAGAATCTTTGCACCAATTTCAGGTTTCTCCTTTCATCTATTTCTTTATCATTGGTGAAG
CTCTTCTATGTATATTACATAGTCATATTGAGAAACTTTTGTCTATCCTATGAAAAATTG
AGGAGTTTTTTTACCAAAATGTAATCGAATATTTTTATATAACAACACCACATATNACTT
TGATCATAGAAAAAGTGGATCATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCAAAAATGTAAATGTCCGCA

Last Updated on 23.10.2014 13:25