SimpleSearch - Line and FST details


Line specific information

 
Line ID 874A06
Vector Used pAC161
Line Availability only available from NASC (N483814)
Segregation Analysis 50:38:31
Confirmed for Hit At1g29270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g29270

 
Sequence (A. th genome BLAST matches underlined)
>41-K026466-022-874-A06-8409
CGGCCATGAAGCCATTTACAATTGAATATGATCCACTCTTTTCTATGATCAAAGTTATAT
GTGGGTGTTGTTATATAAAAATATTCGATTACATTTTGGTAAAAAAACTCCTCAATTTTT
CATAGGATAGACAAAAGTTTCTCAATATGACTATGTAATATACATAGAAGAGCTTCACCA
ATGATAAAGAAATAGATGAAAGGAGAAACCTGAAATTGGGGGAAAGATTCTTTTTTGGTA
ANCTTGANATCNTCNTANTCNCNCNGCNNNNNTNCCCTCCCCCGATCGAACGGNNNACCA
CGCAAANCGGCGNCANAAGAAANCAGANCAAANGAAANNNAAGNCNTTGAAAACCTACAA
TGAGGGACAGCAACGAGAGGAAGGAAGGGGAAGCAGAGAAAAGAGAGCAG
GenBank Accession CR404880 [GenBank]
Graphic View Graphic view of gene At1g29270
Predicted Position of Insertion Chr1:10230618 - go to primer design
BLAST e Value 4e-95
Hit Clone Code (BAC ID) F28N24
Hit Gene Code At1g29270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03