Sequences from confirmation amplicon


Confirmation sequences for line 875E03 and hit At1g68210 are shown.
Line ID 875E03
Locus At1g68210 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:25567907
Primers used for PCR KQ87 - 8474, show primer details
   
Sequence Name 62-K101716-0022-875-E03C-8409
GenBank Accession LN510716 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>62-K101716-0022-875-E03C-8409
GAGCCATTTACATTGAATAATTCCTTGTGGAATTCTTTAGAAAAGAAAAACTCTGCATCA
GCCTCTATCACTCAATGTAAGTATTATTCTATTATATAGATTTTCACGGTGTTACAATTT
GTGTCATATAAGTATTAACAATTTTTTTTTAATGCAGTTTTGTTTAAAAAACCTATTGGT
GAGAAAGAGGAAACAATGCCAAAGTTTCATATAGGCGGGAAATTAGATCTAAGCAATCAT
TCAGTTCATGGTAACGTCCTTAACAAGCTATCTATGAATGTTAACTTCGTTCCTTCAACC
ATAAGTAATAATCCAGCTTACAATATTCTTTCTATCGATAGCTCTAGTATCGATAGCTCT
AGCTATACTGGTTTAGTTTCAACTGGCTTAAGTAGTGAAAATTCTCCTATCCTTTATGGT
TTACCATCGAATGATGGTGCATCTAACACATGCACATCTCAGATGGAATCCGAAAGGATT
TCTATTCCGCAGTATGATCCTAATCAATGTCACCCACATAGATCCATCCTTGAAACTGAT
GTAAACCAAATAGATNTAGATTTTACTTCTATACTAGATTCTTTCGATCCTCTNGTAGAT
GAGTGCCTTAGAAA
   
Sequence Name 62-K101722-0022-875-E03C-KQ87
GenBank Accession LN510717 [GenBank]
Sequencing primer gene specific primer, KQ87: 5'-TTTTCCTTCATAAGGCACTCATCT-3'
Sequence (A. th genome BLAST matches underlined)
>62-K101722-0022-875-E03C-KQ87
GAGTAAATCTAATCTATTTGGTTTACATCAGTTTCAAGGATGGATCTATGTGGGTGACAT
TGATTAGGATCATACTGCGGAATAGAAATCCTTTCGGATTCCATCTGAGATGTGCATGTG
TTAGATGCACCATCATTCGATGGTAAACCATAAAGGATAGGAGAATTTTCACTACTTAAG
CCAGTTGAAACTAAACCAGTATAGCTAGAGCTATCGATACTAGAGCTATCGATAGAAAGA
ATATTGTAAGCTGGATTATTACTTATGGTTGAAGGAACGAAGTTAACATTCATAGATAGC
TTGTTAAGGACGTTACCATGAACTGAATGATTGCTTAGATCTAATTTCCCGCCTATATGA
AACTTTGGCATTGTTTCCTCTTTCTCACCAATAGGTTTTTTAAACAAAACTGCATTAAAA
AAAAATTGTTAATACTTATATGACACAAATTGTAACACCGTGAAAATCTATATAATAGAA
TAATACTTACATTGAGTGATAGAGGCTGATGCAGAGTTTTTCTTTTCTAAAGAATTCCAC
AAGGAATTATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATGTCCGCA

Last Updated on 07.07.2016 14:16