SimpleSearch - Line and FST details


Line specific information

 
Line ID 875E03
Vector Used pAC161
Line Availability only available from NASC (N483955)
Segregation Analysis 49:49:40
Confirmed for Hit At1g68210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g68210

 
Sequence (A. th genome BLAST matches underlined)
>21-K026467-022-875-E03-8409
CCATTTACATTGAATAATTCCTTGTGGAATTCTTTAGAAAAGAAAAACTCTGCATCAGCC
TCTATCACTCAATGTAAGTATTATTCTATTATATAGATTTTCACGGTGTTACAATTTGTG
TCATATAAGTATTAACAATTTTTTTTTAATGCAGTTTTGTTTAAAAAACCTATTGGTGAG
AAAGAGGAAACAATGCCAAAGTTTCATATAGGCGGCAAATTATATCTAAGCAATCATTCA
GTTCATGGTAACGTCCTTAACAAGCTATCTATGAATGTTAACTTCGTTCCTTCAACCATA
AGTAATAATCCAGCTTACAATATTCTTTCTATCGATAGCTCTAGTATCGATAGCTCTAGC
TATACTGGTTTAGTTTCAACTGGCTTAAGTAGTGAAAATTCTCCTATCCTTTATGGTTTA
CCATCGAATGATGGTGCATCTAACACATGCACATCTCAAATGGAATCCGAAAGGATTTCT
ATTCCGCAGTATGATCCTAATCAATGTCACCCACATAAATCCATC
GenBank Accession CR405081 [GenBank]
Graphic View Graphic view of gene At1g68210
Predicted Position of Insertion Chr1:25567907 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T22E19
Hit Gene Code At1g68210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pseudo-response regulator 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23