Sequences from confirmation amplicon


Confirmation sequences for line 877F05 and hit At1g60570 are shown.
Line ID 877F05
Locus At1g60570 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:22312859
Primers used for PCR JF12 - 8474, show primer details
   
Sequence Name 51-K102176-0022-877-F05C-8409
GenBank Accession LN507454 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>51-K102176-0022-877-F05C-8409
ATTTACATTGAATAATCCTGTCTGTTTCATCGCACACCACATCATCGTTTTATGAAAGCC
AAGACCATCACCAGAAGCCACAAACTTATCCCAAAACATTACCATTTTCCCACCATAATC
CGCCAACGTAACACTGGCATGACGAACAAACTTATGCAGTTCTCTCATACCATTCAACAA
ACTTCTCCAAGTTCTTGCCTTAGTGTCATACCATTTGATATCAAGTTCTTCGTAAAAAAA
ATCATAAAGCACGTTCTCTATCACACAACAATAAAACAATGTCAAACACATATCCATCTC
CGGTACTTCTAAACTATCCCATGTATCATCCTTGGGATTGTAAACCACACCCTTATA
   
Sequence Name 51-K102180-0022-877-F05C-JF12
GenBank Accession LN507455 [GenBank]
Sequencing primer gene specific primer, JF12: 5'-GCTGATAAGGGTGTGGTTTACAAT-3'
Sequence (A. th genome BLAST matches underlined)
>51-K102180-0022-877-F05C-JF12
AGTCCGGAGATGGATATGTGTTTGACATTGTTTTATTGTTGTGTGATAGAGAACGTGCTT
TATGATTTTTTTTACGAAGAACTTGATATCAAATGGTATGACACTAAGGCAAGAACTTGG
AGAAGTTTGTTGAATGGTATGAGAGAACTGCATAAGTTTGTTCGTCATGCCAGTGTTACG
TTGGCGGATTATGGTGGGAAAATGGTAATGTTTTGGGATAAGTTTGTGGCTTCTGGTGAT
GGTCTTGGCTTTCATAAAACGATGATGTGGTGTGCGATGAAACAGACAGGATATATTCAA
TTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGAGTTATA

Last Updated on 07.07.2016 14:16