SimpleSearch - Line and FST details


Line specific information

 
Line ID 877F05
Vector Used pAC161
Line Availability only available from NASC (N484161)
Segregation Analysis 50:39:30
Confirmed for Hit At1g60570
Parent of DUPLO pair none
Parent of pair(s) 7699, 72687, 72688

Gene hit At1g60570

 
Sequence (A. th genome BLAST matches underlined)
>38-K026469-022-877-F05-8409
AGCCATTTACAATTGAATATATCCTGGTCTGTTTCATCGCANCACCACATCATCGTTTTA
TGAAAGCCAAGACCATCACCAGAAGCCACAAACTTATCCCAAAACATTACCATTTTCCCA
CCATAATCCGCCAACGTAACACTGGCATGACGAACAAACTTATGCAGTTCTCTCATACCA
TTCAACAAACTTCTCCAAGTTCTTGCCTTAGTGTCATACCATTTGATATCAAGTTCTTCG
TAAAAAAAATCATAAAGCACGTTCTCTATCACACAACAATAAAACAATGTCAAACACATA
TCCATCTCCCGTATGGGATCCTCCNTATAGTGAG
GenBank Accession CR405331 [GenBank]
Graphic View Graphic view of gene At1g60570
Predicted Position of Insertion Chr1:22312859 - go to primer design
BLAST e Value 1e-135
Hit Clone Code (BAC ID) F8A5
Hit Gene Code At1g60570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03