Sequences from confirmation amplicon


Confirmation sequences for line 905C02 and hit At5g03270 are shown.
Line ID 905C02
Locus At5g03270 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:783162
Primers used for PCR MC88 - 8474, show primer details
   
Sequence Name 54-K102176-0022-905-C02C-8409
GenBank Accession LN508429 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>54-K102176-0022-905-C02C-8409
GCCATTTACATTGAATATATCCTGTAATTTAAGAAAAAATTTAAGAGCGTTTCTTATCCA
ATTTAAGAAAAAATTTATGTTCGCAATTTATATCTGTAAGATTTATATTTCTGAGCAGAC
ATTAAAAGATCGTAATATGAGTTGCAAAATGTTGTTTTTCTTTTTTGGGTAGTGCTGGTA
TATTATAAAGTTGAATATTCTGAGAGAAACATAATGGTAACTATTGTGATGAGTGCACTA
ACCTTTGACCTTTGACTTAAAAAGTACCAAAGAGAAGAGAAGGACTACTTTTCATAAATC
AGATGTTGACTTTTCTTAAGAGGTCAAAAATGAAAGTGAAAAAAAAAAAAAATCTTCTTG
AGTTTTACTATACGTGCCACTTGACTAATTCAACGAGTCCCCACTGTCAAAGTGTCAATC
CCCAGGTGGCTATGGTACACTAAAGGAGCTACTTGAAGTGATAACTTGGGCACAACTTGG
TATCCATGATAAACCGGTATGTAAACCGGTTTGGTCTGGTATAAAATAATAACCGACTTT
TTGATAAAGTTAGCTATGGTTTTCTTTTTCTTGCAGGTCGGTTTATTAAACGTTGATGGA
TATTACAATGCATTGCTGTTATTCATCGACAAAGCCTTCAAAAAGGGATTTATTCTTCCA
ACCGCTCGACATAT
   
Sequence Name 54-K102180-0022-905-C02C-MC88
GenBank Accession LN508430 [GenBank]
Sequencing primer gene specific primer, MC88: 5'-TGCAGATACGATAATATGTCGAGC-3'
Sequence (A. th genome BLAST matches underlined)
>54-K102180-0022-905-C02C-MC88
CAGCAATGCATCGTAATATCCATCAACGTTTAATAAACCGACCTGCAAGAAAAAGAAAAC
AATAGCTAACTCTATCAAAATGTCGGTTATTATCTTATACCAGACCAAACCGGTTTACAT
ACCGGTTTATCATGGATACCAAGTTGTGCCCAAGTTATCACTTCAAGTAGCTCCTCTAGT
GTACCATAGCCACCTGAGGATTGACACTTCGACAGTGAGGACTCGTTGACTTAGTCAAGT
GGCACGTATAGTAAAACTCAAGAAGATTTTTTTTTTTTTTCACTTTCATTTTTGACCCCT
TAAAAAAAGTCAACATCTGATTTATGAAAAGTAGCCCTTCCCTTCCCTTTGGAACTTTTT
AAGTCAAAGGTCAAAGGTTAGGGCCCCCATCACAATAGTTACCATTATGTTTCTCTCAAA
AAATTCAACTTTATAATATACCACCCCTCCCCAAAAAAAAAAAACAACATTTTGCAACTC
AAATAACAATCTTTTAATGTCGGCTCAAAAATATAAATCTTACAAATATAAATTGCAAAC
ATAAATTTTTTCTTAAATTGGATAAAAAACCCTCTTAAATTTTTTCTTAAATTACAGGAT
ATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACTTGGATCACCAATGAGTATGA
TGGTCAATATGGAAAAAAAAAAAAAGTAATTACCAATTTTTTTTCATTTCAAAAATGTAA
A

Last Updated on 07.07.2016 14:16