SimpleSearch - Line and FST details


Line specific information

 
Line ID 905C02
Vector Used pAC161
Line Availability only available from NASC (N486810)
Segregation Analysis 50:47:47
Confirmed for Hit At5g03270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g03270

 
Sequence (A. th genome BLAST matches underlined)
>11-K030282-022-905-C02-8409
CGATTTAGGTACCCACCTTATATCTGTAAGATTTATATTTCTGAGCAGACATTAAAAGAT
CGTAATATGAGTTGCAAAATGTTGTTTTTCTTTTTTGGCTACAGCGGATATATTATCCTC
TTCAATCTTATGACAGAGCCATAGAGGCAATCAATGTGA
GenBank Accession CR936087 [GenBank]
Graphic View Graphic view of gene At5g03270
Predicted Position of Insertion Chr5:783140 - go to primer design
BLAST e Value 5e-30
Hit Clone Code (BAC ID) F15A17
Hit Gene Code At5g03270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation lysine decarboxylase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T3P01

 
Sequence (A. th genome BLAST matches underlined)
>11-K114033-0022-905-C02-8409
AATGATGAGAAATCATATAGAATACTCATGAATGATACAATGCTCGCCTGCCCGGCCTCT
ACGGCCGCTATGCGGTTTTTCTTGTTTACCCACAGGGGGCTTTGTAACTTCACCGGCCCG
GGCGTAAAAATACTCTTTATCTCTTTACTTATGCTATATTATCGTTTACCTGCGTTTATG
TCTTTGACCATGCTGTCTGAGTAATGACTTATAATTCTTAGGGATGGGATACAGTAGTTG
TGTAATCCGTAGTCTGTAGAATGGTTAAATTTTANAATTGATTGAATCCCTTTAGGACTA
ACCTGCCCTACCGCTA
GenBank Accession HE665718 [GenBank]
Graphic View Graphic view of sequence HE665718 of line 905C02
Predicted Position of Insertion Chr5:11331470 - go to primer design
BLAST e Value 1e-72
Hit Clone Code (BAC ID) T3P01
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03