SimpleSearch - Line and FST details


Line specific information

 
Line ID 007C10
Vector Used pAC106
Line Availability only available from NASC (N400610)
Segregation Analysis 100:88:70
Confirmed for Hit At3g27810
Parent of DUPLO pair none
Parent of pair(s) 2651, 95599

Gene hit At3g27810

 
Sequence (A. th genome BLAST matches underlined)
>75-K014799-022-007-C10-8409
GTGATCCATAGTAGATATTCCCGGACATGAAGCACTTTACAATTGAATACTTACATGCCT
CTATATCTTTGTATCATTTATCTCATCTATGCTAATAAGCTGCTACCCTATGGGAGTCCT
ATCTGTATATAGAGCTGGAAAATCTGGCCCAAAGTACAAGGTACACTGATTCTCTAATTC
AACAAATTAAATGGTATATTTTGTTTTTAAGTAAGTGCGAATAGACTTACATATTTTATC
ATCTAACCTATGGGATCCTCCCTTAAGTGAG
GenBank Accession AL935860 [GenBank]
Graphic View Graphic view of gene At3g27810
Predicted Position of Insertion Chr3:10308863 - go to primer design
BLAST e Value 5e-56
Hit Clone Code (BAC ID) MGF10
Hit Gene Code At3g27810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 21
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR799918 [GenBank] FR799918 [GenBank]


Last Updated on 31.08.2016 09:40