SimpleSearch - Line and FST details


Line specific information

 
Line ID 010H02
Vector Used pAC106
Line Availability only available from NASC (N400950)
Segregation Analysis 59:54:49
Confirmed for Hit MGH6 At1g78130
Parent of DUPLO pair none
Parent of pair(s) 732, 7944

Gene hit MGH6

 
Sequence (A. th genome BLAST matches underlined)
>11-K118207-0022-010-H02C-3144
CACTATCCTTCGCAGAACCTTTCTCCATATAAGGAAGTTCATTTTCATTTGGAGAGGACA
GGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGATC
CACAATGCAATTGAATCATTGTTTTCAGTATTCATGTTGAGTTCAGTTTAATCGGTTTGA
TTTCAAGATGTGCTCATTCATGTCTTAGATATGTATCTTTAAACCAAACTTTTCAGCTCA
ACTAGAACATGTCATCGCCTCAACATAGTGGAGATCAAGAAAAGTGGCATGTGACTGTTT
GAGTTTTAAGAAATAGGCAAAAATACATGTTATAAAGTTTGCAAGTTTATCACTGCCTTA
CGAAGTTAGATCAGCACTAATTTCCCACTCACTTGCCAAAATGCTAATATAAAATATGGG
AACAAAGATACTATTGATTGGATTCTGCAGATGAAAAAAAGGTGTCGCAATCATCCAACT
TAGGCATCT
GenBank Accession HG967695 [GenBank]
Graphic View Graphic view of sequence HG967695 of line 010H02
Predicted Position of Insertion Chr3:4116279 - go to primer design
BLAST e Value 1e-164
Hit Clone Code (BAC ID) MGH6
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g78130

 
Sequence (A. th genome BLAST matches underlined)
>46-K016930w-022-010-H02T-8409
TCCTGGCCAGCTCCCGGCGGTCTCTCCTGGAGCGGGCGATCTTCACACAAAAAACTTGCG
TGCCACTCAGTCGCGTGCAGGACGGTACCGCTGTTTGGCCTAGTCCTGATCGTCGCGTGC
TGACGCGAAACATAGCCCAGCCAGACACTAGCAGAGCTCTTGCCCATGAAGTAATGAGCA
CCGGTACTACCGCTGCTCACATATAGTGGGATCTATCTTGCCATCGATTGCACCTCCTAT
AGTAGGAATCCTGGCACCCACGCTTATGGATACAAGCCAATCCCTGAAGGGTCATCGAGG
TCAACAGAGATAGCCACAGATAGAGAGAATGCAGCATCTCTGGCAAAAGCTCTTTATACA
TCTATAGGACTCCCAATGGCGGCTTGCTGCTTCATATACTCCTTTCTTTACCGTTCCTAT
CCTCTATGGGACCTCCCCNAATAGTGAGAAANNTNNTATANATTCTGANATGCTTNAACT
TCTTCCAAAAAGTTCCAATCNAGACATTGAGTTTTCACAAAAAAAAGACCCCTTTGCAAA
CCATGTTAACCCCAATTTACAAGCTATGGGATCCTCCCCTAAAGTGAGAGGGGAAAAAAG
GAGAAAGAAACGAAAAA
GenBank Accession BX572112 [GenBank]
Graphic View Graphic view of gene At1g78130
Predicted Position of Insertion Chr1:29401270 - go to primer design
BLAST e Value 1e-99
Hit Clone Code (BAC ID) T11I11
Hit Gene Code At1g78130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX572111 [GenBank] BX572112 [GenBank]


Last Updated on 31.08.2016 09:40