SimpleSearch - Line and FST details


Line specific information

 
Line ID 032D06
Vector Used pAC106
Line Availability only available from NASC (N403018)
Segregation Analysis 100:32:31
Confirmed for Hit At4g09460
Parent of DUPLO pair none
Parent of pair(s) 2858, 3276

Gene hit At3g10220

 
Sequence (A. th genome BLAST matches underlined)
>44-K027913-022-032-D06-8409
AAGCCATTTACATTGAATATATCCTGGGCACTCTGAGAATCTTGTTCCTTTCACCCTGCA
AATGTAAGCCAGTATTAAATATGTGGGATCTGACAACCGAACTTCCACAAATTGTATGGG
ATCCTCCCTATATTGAGTCGTATTACTCACCTACTTTTCAACTTACTGTTCCCAATATCA
CTTTTAACATCATCCGTCTGATGGCGTTGCGAGAGAATCATTCGATCCGTGAGATCAGCC
GACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTATTTGAACGCAGGTATGGGATCCT
CCCTATAGTGAGTCCTATTACTCACTCTTTTTTAATATTACCTTTTAAAAT
GenBank Accession FR800973 [GenBank]
Graphic View Graphic view of gene At3g10220
Predicted Position of Insertion Chr3:3163573 - go to primer design
BLAST e Value 1e-39
Hit Clone Code (BAC ID) F14P13
Hit Gene Code At3g10220 [TAIR] [MIPS] [SIGnAL]
Gene Annotation tubulin folding cofactor B
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit FR800972 [GenBank]

Gene hit At4g09460

 
Sequence (A. th genome BLAST matches underlined)
>04-K118495-0022-032-D06C-35St
TCCACTATCCTTGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGCGTACAG
GGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGATTGTCGTTT
TATGTCAGGGTAAGCCATTTTTGTCGACTCTGTTTCCTAGAAAGTTGAAACTTTTTTCCT
GGGAAAGATCAAAGAAGAAGAAAGAGCAGGAAAACAAAGTGACCCAGTTTCTATTTTCTC
TCTGTTTCCTAGAAAGTTGAAATCTTTTTCCTAGAAACAAGAGTAGGGAGAAAAAAAAAA
GTGACTCTGTTTTTCTATTTTCACTCTGTTTTTTTAGAAGAAGAGAAAGAGAGGAAAAAG
TTATCGTACTTGTTACCGAGTAAGCTATGGAGTTTGATGATGATTTGATCTTCATCATCA
GTAAAATTACCACGTTTAAAATCAGGACGAAGGTAATTAATCCATCTCAATCTACAACTT
TTACCACAACGCAACAATCCAGCGGATTTAGGAAAAGAACGCCAACAACCTTCACCGTGA
TTACGGATATAATCTACAAGACGTTGATCTTCTTCTTTAGTCCAAGCTCCTTTGTTTGTG
TGAGCTTTTTCACAACAAGGAGATCTTCCCATGGTGAATGAAGAAAATGGTGTAAGAGAA
GAGAGAAGAGATCAATTTGTGGGTTATATAAAAAGGAGGAGACTTTGACTAATTTTGGTA
TATGTACATGTGACTATGTGGAGATAAAGTGAGGCTGTGCTTTGCTGTGTTGTGTGTGGG
GenBank Accession HG968612 [GenBank]
Graphic View Graphic view of gene At4g09460
Predicted Position of Insertion Chr4:5993506 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T15G18
Hit Gene Code At4g09460 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23