SimpleSearch - Line and FST details


Line specific information

 
Line ID 034F02
Vector Used pAC161
Line Availability only available from NASC (N403230)
Segregation Analysis 100:83:57
Confirmed for Hit At3g18580
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18580

 
Sequence (A. th genome BLAST matches underlined)
>14-K015007-022-034-F02-8409
CTGATCCATGTAGACTTTCCCGGACATGATACATATTGATCAATATTACTCTGTATAGAT
CAATTTTGCCTCCATGGAGAGAAAACAGAGATCAATATTTAATTGTTTCCCAATGAAATA
TGTAAGAAATGGAGTTTTAGGGGTTGAGCCATTAGTACCGTTTCTACGAATTGCTACTTC
TCTTATACGTCGAACCAAACCAGTGACAGGATCAGTGAATATCTTCGTCTCCAGATTACC
CTCTAAGTAGATAACAGTACTGTTGAATGAACACGAAACAAGTTGTTATGACACATACAC
AAAAGCAAGCTACCATTTTGAACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL763191 [GenBank]
Graphic View Graphic view of gene At3g18580
Predicted Position of Insertion Chr3:6397009 - go to primer design
BLAST e Value 3e-137
Hit Clone Code (BAC ID) K24M9
Hit Gene Code At3g18580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleic acid-binding, OB-fold-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40