SimpleSearch - Line and FST details


Line specific information

 
Line ID 046H03
Vector Used pAC161
Line Availability only available from NASC (N404407)
Segregation Analysis 100:100:62
Confirmed for Hit At5g66220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g20140

 
Sequence (A. th genome BLAST matches underlined)
>24-K016080-022-046-H03-8409
GATCATGTAGATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCAAGTACCAG
AGTAGATTAGATTCCAGGAAATGATTATCTAAATACCAATTTGCGCATAAACCAACCTCC
TCCTTCTTTCTCGATTTACCATGTCATCTATACAAAGCAGAAACAGAATTTCAGAAGAAA
AAATTTAAAGTTGGCAGTTTTCATGTCTCCGAAGACATTTGCAGGTGTCAGTTTTTTTAC
AGCTTCTTATAACCGGCCGTTCTGATGTTGTATACATGGAGAAGACTATCACAAGCTTGC
CTATGGGATCCTCCCCTATAGTGAGAAACAGCCGGAGGAAAAGTAAATGCGTCGACGTGG
AGTGGCGTCACGGAAGGCAGCGGCATGGGCGACGAGGAAGACCAACTCAAGCCTATGGGA
TCCTCCCTATAGTGAGAGGGCTTGGACATCGTTTCCTGCAACTGATCGTCAGCCTCTTCA
TCCTGCTCTGCATCACGTTCATCATCGGCCGCGTCATGCCGACCGATCCGGTCGGCGCGA
TCGTCGGCGAGCTTGCCGATCCCAAAGCCTATGAGGCAATGAGGGCACGGCTTGATCTCG
ATCTGCCGCTCTACCAGCAGTTCTTCATTTATCTGCGCGGCCTGCTCCATGGCGATTT
GenBank Accession AL936221 [GenBank]
Graphic View Graphic view of gene At4g20140
Predicted Position of Insertion Chr4:10888223 - go to primer design
BLAST e Value 3e-69
Hit Clone Code (BAC ID) F1C12
Hit Gene Code At4g20140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat transmembrane protein kinase
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At5g66220

 
Sequence (A. th genome BLAST matches underlined)
>24-K016075-022-046-H03-8409
TGATCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATGTACCAGAGGAGGATCA
TGGCTATATATCGATGATGCGCTGATGATAGACGTTTTAGAACTGTCGTGAGCCATTTAC
AATATATGATATCTGCTACTGCTTATATCTATTATAGGGTACTCTGATGATATGCTATGG
GATACCTACCCTATAATTGAGAAAGTTCTGGTGAAACTCAAGCTATGGGATCCTCCCTAT
AGTGAGATGCTGCTGCGTGCATTAATTGTATAGACAGACTATGATGCTAACCTGCACCAC
CGAGGAAAAGTCTTTTGTGGGAAGCGGGCGACTCAACAGCCGGAGGAAAAGTAAATGCGT
CTACGTGGAGTGGCGTCACGGAAGGCAGCGGCATGGGCGACGAGGAAGACCAACTCAAGT
CTATGGGATCCTCCCTATAGTGAGANGAGGATACGCGANTNTCNACCCCGTTTGTGATGG
CCTAAGAACGTCGCACCTCGCACGGCTTCTTCATCCTCGCGGAGCCGTTTCAATTTCGTG
AAGCTTGGGACCTCGGGAAAAAGTTG
GenBank Accession AL936220 [GenBank]
Graphic View Graphic view of gene At5g66220
Predicted Position of Insertion Chr5:26461512 - go to primer design
BLAST e Value 1e-90
Hit Clone Code (BAC ID) K2A18
Hit Gene Code At5g66220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone-flavanone isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03