SimpleSearch - Line and FST details


Line specific information

 
Line ID 049D04
Vector Used pAC161
Line Availability only available from NASC (N404648)
Segregation Analysis 100:88:81
Confirmed for Hit At4g34890
Parent of DUPLO pair none
Parent of pair(s) 12799

Gene hit At4g34890

 
Sequence (A. th genome BLAST matches underlined)
>28-K013871-022-049-D04-8409
NTTGGATCCATGTAGACTTTCCTGTACATGAAGCCCTTTACAATTGAATATATCCTGCAG
CAATAATGCAATTGCTGATCCATGTAGATTTCTGGGGGAATGGTGGAGTTTCGGAAATCT
CTAACCCTAAGCTTCTTCTTTAAATTTTTCTTATGGGTTTCTCATAATGTCAATAATGCA
AATTCTGCGATAGAGACCTTCCCACCCTCCCATATGTCAGCTGTGCAACCTGTTCCTCGG
TTACCTATGGGATCCTCCCTATAGTGAGACCACNCCCCCCCC
GenBank Accession AL753365 [GenBank]
Graphic View Graphic view of gene At4g34890
Predicted Position of Insertion Chr4:16622845 - go to primer design
BLAST e Value 2e-80
Hit Clone Code (BAC ID) F11I11
Hit Gene Code At4g34890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation xanthine dehydrogenase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR801336 [GenBank]


Last Updated on 07.07.2016 14:03